Incidental Mutation 'R3771:Kat6b'
ID273302
Institutional Source Beutler Lab
Gene Symbol Kat6b
Ensembl Gene ENSMUSG00000021767
Gene NameK(lysine) acetyltransferase 6B
SynonymsMyst4, monocytic leukemia, querkopf, B130044K16Rik, Morf, qkf
MMRRC Submission 040747-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R3771 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location21481434-21672478 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21517098 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 75 (D75G)
Ref Sequence ENSEMBL: ENSMUSP00000138421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069648] [ENSMUST00000112458] [ENSMUST00000182405] [ENSMUST00000182855] [ENSMUST00000182964] [ENSMUST00000182996]
Predicted Effect probably damaging
Transcript: ENSMUST00000069648
AA Change: D75G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066693
Gene: ENSMUSG00000021767
AA Change: D75G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 594 772 4.5e-85 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000096222
SMART Domains Protein: ENSMUSP00000093937
Gene: ENSMUSG00000021767

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 317 8.71e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112458
AA Change: D75G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108077
Gene: ENSMUSG00000021767
AA Change: D75G

DomainStartEndE-ValueType
H15 94 159 3.4e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182405
AA Change: D75G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138377
Gene: ENSMUSG00000021767
AA Change: D75G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182855
AA Change: D75G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138511
Gene: ENSMUSG00000021767
AA Change: D75G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
Pfam:MOZ_SAS 482 669 1.3e-89 PFAM
coiled coil region 702 736 N/A INTRINSIC
coiled coil region 766 804 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 1044 1066 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1282 1301 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1381 1408 N/A INTRINSIC
low complexity region 1567 1586 N/A INTRINSIC
low complexity region 1702 1723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182859
Predicted Effect probably damaging
Transcript: ENSMUST00000182964
AA Change: D75G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138421
Gene: ENSMUSG00000021767
AA Change: D75G

DomainStartEndE-ValueType
H15 94 171 1.7e-12 SMART
low complexity region 189 203 N/A INTRINSIC
PHD 216 271 6.6e-5 SMART
PHD 272 319 5.56e-12 SMART
low complexity region 386 398 N/A INTRINSIC
low complexity region 411 425 N/A INTRINSIC
Blast:PHD 483 573 3e-51 BLAST
Pfam:MOZ_SAS 591 778 1.4e-89 PFAM
coiled coil region 811 845 N/A INTRINSIC
coiled coil region 875 913 N/A INTRINSIC
low complexity region 926 943 N/A INTRINSIC
low complexity region 946 959 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1207 1237 N/A INTRINSIC
low complexity region 1391 1410 N/A INTRINSIC
low complexity region 1450 1464 N/A INTRINSIC
low complexity region 1490 1517 N/A INTRINSIC
low complexity region 1676 1695 N/A INTRINSIC
low complexity region 1811 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182996
AA Change: D75G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183228
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Reduced expression of this gene results in developmental defects of the skeleton and brain, particularly the cerebral cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,931,196 Y377H probably damaging Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Aanat G T 11: 116,596,871 G132V probably damaging Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adam26b T A 8: 43,520,714 D417V probably damaging Het
Ank1 T C 8: 23,123,897 S1482P probably benign Het
Armc2 C T 10: 41,922,227 V768M probably damaging Het
Ascc3 C T 10: 50,720,718 probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cdh12 A T 15: 21,578,554 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Cxcr6 A G 9: 123,810,485 I184V probably benign Het
Dagla G A 19: 10,248,467 P778S possibly damaging Het
Ddx19b T C 8: 111,020,981 K107R probably benign Het
Dpyd G A 3: 119,412,278 probably null Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Fam13a T G 6: 58,987,186 K87T probably benign Het
Fap C A 2: 62,533,010 S359I probably damaging Het
Fbxo39 T C 11: 72,317,215 I131T possibly damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Irf2bp2 T C 8: 126,591,811 K339E probably damaging Het
Kcnab3 A G 11: 69,328,563 T127A probably damaging Het
Kdm5b G T 1: 134,613,345 C725F probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Lrrn3 T A 12: 41,452,870 I483L probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Med23 G T 10: 24,902,201 G810C probably damaging Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Numb T C 12: 83,799,576 D344G probably damaging Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Ogg1 T C 6: 113,333,843 V317A possibly damaging Het
Olfr822 A G 10: 130,075,274 Y288C probably damaging Het
Olfr97 T A 17: 37,231,465 I302F possibly damaging Het
Pclo A T 5: 14,539,408 probably null Het
Pnpt1 T C 11: 29,138,174 M195T probably benign Het
Polr3c T A 3: 96,725,854 T43S probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rasl10b A T 11: 83,418,523 T134S probably benign Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf39 T C 17: 36,947,229 W96R probably damaging Het
Ros1 G T 10: 52,128,991 A949E probably damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tc2n T A 12: 101,694,574 Q133L possibly damaging Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tex2 T C 11: 106,546,894 D650G unknown Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugcg T C 4: 59,189,690 F16S probably benign Het
Usp16 T C 16: 87,458,683 M1T probably null Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Vpreb3 A T 10: 75,939,966 V26E probably benign Het
Vps39 C T 2: 120,342,016 V179I possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Kat6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Kat6b APN 14 21668559 missense probably benign 0.00
IGL01128:Kat6b APN 14 21660860 missense probably benign
IGL02272:Kat6b APN 14 21626778 missense probably damaging 0.99
IGL02349:Kat6b APN 14 21637593 missense probably damaging 0.99
IGL02402:Kat6b APN 14 21631347 missense probably damaging 1.00
IGL02474:Kat6b APN 14 21669039 missense possibly damaging 0.95
IGL02516:Kat6b APN 14 21609868 splice site probably benign
IGL02666:Kat6b APN 14 21628870 missense probably damaging 1.00
IGL02971:Kat6b APN 14 21669758 missense probably damaging 1.00
IGL03075:Kat6b APN 14 21661570 nonsense probably null
IGL03274:Kat6b APN 14 21609763 missense possibly damaging 0.95
IGL03308:Kat6b APN 14 21624834 missense probably damaging 0.99
R0118:Kat6b UTSW 14 21669974 missense probably damaging 0.99
R0383:Kat6b UTSW 14 21669081 missense probably benign 0.02
R0441:Kat6b UTSW 14 21670233 missense probably damaging 1.00
R0457:Kat6b UTSW 14 21670530 missense probably damaging 0.96
R0558:Kat6b UTSW 14 21669421 missense probably benign 0.03
R0662:Kat6b UTSW 14 21662349 small deletion probably benign
R0684:Kat6b UTSW 14 21668781 missense probably benign
R0755:Kat6b UTSW 14 21637593 missense probably damaging 0.99
R1216:Kat6b UTSW 14 21622040 nonsense probably null
R1479:Kat6b UTSW 14 21618956 missense probably benign 0.19
R1873:Kat6b UTSW 14 21516989 missense probably damaging 1.00
R1957:Kat6b UTSW 14 21628879 missense probably damaging 1.00
R2151:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2152:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2153:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2154:Kat6b UTSW 14 21668667 missense probably benign 0.02
R2399:Kat6b UTSW 14 21662349 small deletion probably benign
R3740:Kat6b UTSW 14 21670044 missense probably damaging 0.99
R4178:Kat6b UTSW 14 21618904 nonsense probably null
R4261:Kat6b UTSW 14 21669669 missense probably damaging 1.00
R4551:Kat6b UTSW 14 21661448 missense probably damaging 1.00
R4724:Kat6b UTSW 14 21660962 missense probably benign
R5055:Kat6b UTSW 14 21516994 missense probably damaging 0.99
R5098:Kat6b UTSW 14 21619015 splice site probably benign
R5121:Kat6b UTSW 14 21619258 missense probably damaging 0.98
R5158:Kat6b UTSW 14 21669986 missense possibly damaging 0.93
R5488:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5489:Kat6b UTSW 14 21669264 missense probably damaging 1.00
R5653:Kat6b UTSW 14 21669372 missense probably benign 0.10
R5742:Kat6b UTSW 14 21668435 missense probably damaging 0.99
R5868:Kat6b UTSW 14 21634479 missense probably damaging 1.00
R5969:Kat6b UTSW 14 21670792 missense probably damaging 0.97
R6110:Kat6b UTSW 14 21670487 missense probably damaging 1.00
R6427:Kat6b UTSW 14 21517412 missense probably benign 0.24
R6457:Kat6b UTSW 14 21670680 missense probably damaging 1.00
R6639:Kat6b UTSW 14 21517494 missense possibly damaging 0.57
R6891:Kat6b UTSW 14 21669036 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTGGATTCTTGAAGCAGTGC -3'
(R):5'- TGGTGCCTGTAAGATCACTCTG -3'

Sequencing Primer
(F):5'- TCTTGAAGCAGTGCAGAAAATC -3'
(R):5'- AAGATCACTCTGGCTTCTCAGATAC -3'
Posted On2015-03-25