Incidental Mutation 'R3772:Ap1g1'
ID273359
Institutional Source Beutler Lab
Gene Symbol Ap1g1
Ensembl Gene ENSMUSG00000031731
Gene Nameadaptor protein complex AP-1, gamma 1 subunit
SynonymsD8Ertd374e, Adtg, gamma-adaptin
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location109778554-109864204 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109837786 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 324 (D324G)
Ref Sequence ENSEMBL: ENSMUSP00000090844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034171] [ENSMUST00000093157]
Predicted Effect probably damaging
Transcript: ENSMUST00000034171
AA Change: D321G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034171
Gene: ENSMUSG00000031731
AA Change: D321G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 574 7.8e-157 PFAM
low complexity region 626 636 N/A INTRINSIC
low complexity region 653 667 N/A INTRINSIC
low complexity region 668 676 N/A INTRINSIC
Alpha_adaptinC2 699 817 6.37e-46 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093157
AA Change: D324G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090844
Gene: ENSMUSG00000031731
AA Change: D324G

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:Adaptin_N 23 577 1.1e-155 PFAM
low complexity region 629 639 N/A INTRINSIC
low complexity region 656 670 N/A INTRINSIC
low complexity region 671 679 N/A INTRINSIC
Alpha_adaptinC2 702 820 6.37e-46 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122558
Meta Mutation Damage Score 0.418 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptins are important components of clathrin-coated vesicles transporting ligand-receptor complexes from the plasma membrane or from the trans-Golgi network to lysosomes. The adaptin family of proteins is composed of four classes of molecules named alpha, beta-, beta prime- and gamma- adaptins. Adaptins, together with medium and small subunits, form a heterotetrameric complex called an adaptor, whose role is to promote the formation of clathrin-coated pits and vesicles. The protein encoded by this gene is a gamma-adaptin protein and it belongs to the adaptor complexes large subunits family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit complete embryonic lethality before implantation. Heterozygotes display slow postnatal weight gain, decreased CD4-positive, alpha beta T cell number in the thymus, and decreased body size up to 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Strada C T 11: 106,164,822 R333Q probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Ap1g1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Ap1g1 APN 8 109832782 missense possibly damaging 0.85
IGL01907:Ap1g1 APN 8 109843343 splice site probably benign
IGL02248:Ap1g1 APN 8 109863433 utr 3 prime probably benign
IGL02548:Ap1g1 APN 8 109849622 missense probably damaging 1.00
Collapse UTSW 8 109828336 critical splice donor site probably null
Deflate UTSW 8 109851132 critical splice donor site probably null
depress UTSW 8 109838920 missense probably damaging 1.00
R0158:Ap1g1 UTSW 8 109855635 missense probably benign 0.00
R0226:Ap1g1 UTSW 8 109855062 missense probably benign 0.39
R0254:Ap1g1 UTSW 8 109803117 missense probably benign 0.01
R0315:Ap1g1 UTSW 8 109819035 missense probably benign
R0380:Ap1g1 UTSW 8 109803164 splice site probably benign
R0471:Ap1g1 UTSW 8 109853643 missense possibly damaging 0.90
R0508:Ap1g1 UTSW 8 109837732 splice site probably benign
R0837:Ap1g1 UTSW 8 109851065 missense probably damaging 1.00
R1025:Ap1g1 UTSW 8 109818939 missense probably benign 0.24
R1700:Ap1g1 UTSW 8 109853612 missense probably damaging 1.00
R1759:Ap1g1 UTSW 8 109833221 missense probably damaging 1.00
R1809:Ap1g1 UTSW 8 109833182 splice site probably benign
R2161:Ap1g1 UTSW 8 109844354 missense probably damaging 1.00
R3428:Ap1g1 UTSW 8 109843448 missense probably damaging 1.00
R3897:Ap1g1 UTSW 8 109854999 missense probably damaging 0.97
R4244:Ap1g1 UTSW 8 109833490 missense probably benign 0.04
R4714:Ap1g1 UTSW 8 109829620 missense probably damaging 0.98
R4736:Ap1g1 UTSW 8 109855082 missense possibly damaging 0.93
R5173:Ap1g1 UTSW 8 109851132 critical splice donor site probably null
R5185:Ap1g1 UTSW 8 109863326 utr 3 prime probably benign
R5435:Ap1g1 UTSW 8 109838920 missense probably damaging 1.00
R5685:Ap1g1 UTSW 8 109837783 missense probably damaging 0.99
R5824:Ap1g1 UTSW 8 109838912 splice site probably null
R5867:Ap1g1 UTSW 8 109818982 missense probably damaging 1.00
R6339:Ap1g1 UTSW 8 109844368 missense possibly damaging 0.85
R6978:Ap1g1 UTSW 8 109828336 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCATCTTTAGGGAGCTTCTAC -3'
(R):5'- TGCCTTACCCACAATGTACAAAAGG -3'

Sequencing Primer
(F):5'- ATCTTTAGGGAGCTTCTACCCAGAG -3'
(R):5'- TGGATCTCTAAGTTCAAGGCCAGC -3'
Posted On2015-03-25