Incidental Mutation 'R3772:Strada'
ID273376
Institutional Source Beutler Lab
Gene Symbol Strada
Ensembl Gene ENSMUSG00000069631
Gene NameSTE20-related kinase adaptor alpha
Synonyms2610019A05Rik, 6030402H20Rik
MMRRC Submission 040748-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R3772 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106163330-106202168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106164822 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 333 (R333Q)
Ref Sequence ENSEMBL: ENSMUSP00000007444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007444] [ENSMUST00000045923] [ENSMUST00000064545] [ENSMUST00000100326] [ENSMUST00000103072] [ENSMUST00000106875] [ENSMUST00000152008]
Predicted Effect probably damaging
Transcript: ENSMUST00000007444
AA Change: R333Q

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007444
Gene: ENSMUSG00000069631
AA Change: R333Q

DomainStartEndE-ValueType
Pfam:Pkinase 69 379 2.4e-37 PFAM
Pfam:Pkinase_Tyr 70 302 2.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045923
SMART Domains Protein: ENSMUSP00000045357
Gene: ENSMUSG00000040699

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064545
SMART Domains Protein: ENSMUSP00000067070
Gene: ENSMUSG00000040699

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100326
SMART Domains Protein: ENSMUSP00000097900
Gene: ENSMUSG00000075480

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103072
AA Change: R296Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099361
Gene: ENSMUSG00000069631
AA Change: R296Q

DomainStartEndE-ValueType
Pfam:Pkinase 32 342 2.2e-35 PFAM
Pfam:Pkinase_Tyr 33 266 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106875
SMART Domains Protein: ENSMUSP00000102488
Gene: ENSMUSG00000040699

DomainStartEndE-ValueType
LIM 40 92 3.93e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122989
Predicted Effect probably benign
Transcript: ENSMUST00000152008
SMART Domains Protein: ENSMUSP00000115555
Gene: ENSMUSG00000069631

DomainStartEndE-ValueType
Pfam:Pkinase 32 159 7.4e-16 PFAM
Pfam:Pkinase_Tyr 33 159 1.5e-10 PFAM
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
Abcb11 T A 2: 69,329,376 probably benign Het
Adgrl1 A G 8: 83,923,004 N97S possibly damaging Het
Aldh1a2 A G 9: 71,252,920 D76G probably damaging Het
Aldh3a1 A G 11: 61,214,605 E179G possibly damaging Het
Ap1g1 A G 8: 109,837,786 D324G probably damaging Het
Arfgap2 A G 2: 91,265,366 T12A probably benign Het
Aurka A G 2: 172,366,960 L85P probably benign Het
Birc6 T A 17: 74,618,429 probably benign Het
Bmp7 A T 2: 172,870,222 I403N probably damaging Het
Carns1 A G 19: 4,170,916 probably benign Het
Ccdc88c G A 12: 100,966,100 probably benign Het
Ccl2 C T 11: 82,036,958 A76V probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Clstn2 A G 9: 97,582,562 I180T probably damaging Het
Col24a1 T C 3: 145,545,286 L1680P probably damaging Het
Col4a6 C A X: 141,172,200 G1416C probably damaging Het
Ctnna2 T G 6: 76,973,769 N573T probably damaging Het
Cts8 G A 13: 61,250,901 probably benign Het
Cxcl17 A G 7: 25,400,329 probably benign Het
Defb18 T C 1: 18,236,621 H37R possibly damaging Het
Dis3l2 T C 1: 86,854,408 I229T probably benign Het
Dysf G A 6: 84,152,351 S1474N possibly damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
F13a1 T C 13: 36,898,134 K532R probably benign Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Focad A C 4: 88,336,161 probably benign Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Frrs1 T G 3: 116,878,387 S45A possibly damaging Het
Gm5422 T A 10: 31,248,514 noncoding transcript Het
Gm5866 T C 5: 52,582,746 noncoding transcript Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Iglon5 A T 7: 43,480,613 Y42* probably null Het
Khdrbs2 C T 1: 32,244,076 Q90* probably null Het
Krt74 T C 15: 101,762,195 noncoding transcript Het
Lamc2 T A 1: 153,124,251 M1121L probably benign Het
Lrig1 A G 6: 94,605,817 L1073P probably benign Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Man2c1 C A 9: 57,140,377 probably benign Het
Megf10 G A 18: 57,283,862 D768N probably benign Het
Mycbp2 T C 14: 103,133,788 N4108S possibly damaging Het
Nid1 A G 13: 13,476,418 probably benign Het
Nnt A G 13: 119,396,952 V59A probably damaging Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Olfr99 T C 17: 37,279,854 T189A probably benign Het
Pag1 G A 3: 9,699,628 T155M probably benign Het
Pgam5 T C 5: 110,265,593 H176R probably damaging Het
Pid1 T C 1: 84,038,197 D149G probably damaging Het
Pkp3 G A 7: 141,082,346 M1I probably null Het
Pld2 C T 11: 70,544,123 probably benign Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rab9b T A X: 136,861,449 E67D probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rnf214 T C 9: 45,866,634 M625V possibly damaging Het
Rwdd2a A C 9: 86,574,161 N130T possibly damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Sept10 A T 10: 59,176,887 M303K probably damaging Het
Sez6l2 A G 7: 126,959,203 E339G probably damaging Het
Sf3b1 C A 1: 54,999,991 probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
St18 A T 1: 6,844,329 K799I probably damaging Het
Stradb A T 1: 58,985,385 I64L probably benign Het
Sun1 A G 5: 139,238,820 probably benign Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tnk2 A G 16: 32,679,822 D651G probably damaging Het
Trim43c A T 9: 88,847,757 D417V probably damaging Het
Tsc22d4 T C 5: 137,759,233 L374P possibly damaging Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ubr4 T C 4: 139,452,700 V262A possibly damaging Het
Vmn2r60 A T 7: 42,116,556 N29I probably benign Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 C T 15: 88,780,787 P353S probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp426 A T 9: 20,473,117 probably null Het
Zwilch A T 9: 64,156,034 F286I probably benign Het
Other mutations in Strada
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Strada APN 11 106171150 splice site probably benign
IGL00870:Strada APN 11 106171257 missense probably damaging 1.00
IGL01564:Strada APN 11 106173292 missense probably damaging 1.00
IGL02508:Strada APN 11 106168356 missense probably benign 0.03
IGL02816:Strada APN 11 106164425 unclassified probably benign
IGL03008:Strada APN 11 106170957 missense probably damaging 1.00
IGL03107:Strada APN 11 106164037 unclassified probably benign
R0587:Strada UTSW 11 106170964 missense probably damaging 1.00
R1614:Strada UTSW 11 106168319 missense probably damaging 1.00
R1764:Strada UTSW 11 106164184 missense probably damaging 0.96
R1852:Strada UTSW 11 106171221 missense possibly damaging 0.65
R4329:Strada UTSW 11 106187173 utr 5 prime probably benign
R4538:Strada UTSW 11 106167825 missense probably damaging 1.00
R5532:Strada UTSW 11 106171017 missense probably damaging 1.00
R6102:Strada UTSW 11 106168436 missense probably benign 0.01
R6135:Strada UTSW 11 106173314 missense probably damaging 0.99
R6337:Strada UTSW 11 106173317 missense possibly damaging 0.80
R6773:Strada UTSW 11 106164907 missense probably damaging 0.99
R7155:Strada UTSW 11 106171039 missense probably damaging 1.00
R7509:Strada UTSW 11 106187094 missense unknown
R7552:Strada UTSW 11 106187004 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCATGTGAGAGTCGCAGC -3'
(R):5'- CCCATTTGTTCAAGGGAGGAGG -3'

Sequencing Primer
(F):5'- ATGTGAGAGTCGCAGCCTCTG -3'
(R):5'- CATTTGTTCAAGGGAGGAGGAGATC -3'
Posted On2015-03-25