Incidental Mutation 'R3773:Olfr345'
ID273404
Institutional Source Beutler Lab
Gene Symbol Olfr345
Ensembl Gene ENSMUSG00000059251
Gene Nameolfactory receptor 345
SynonymsGA_x6K02T2NLDC-33334179-33335114, MOR136-7
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36640041-36640976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36640321 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 94 (Y94F)
Ref Sequence ENSEMBL: ENSMUSP00000076122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076850]
Predicted Effect probably benign
Transcript: ENSMUST00000076850
AA Change: Y94F

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000076122
Gene: ENSMUSG00000059251
AA Change: Y94F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.6e-57 PFAM
Pfam:7tm_1 41 290 2.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Olfr345
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03323:Olfr345 APN 2 36640141 missense possibly damaging 0.95
IGL03399:Olfr345 APN 2 36640882 missense possibly damaging 0.78
R1164:Olfr345 UTSW 2 36640120 missense probably benign
R1878:Olfr345 UTSW 2 36640189 missense possibly damaging 0.83
R1879:Olfr345 UTSW 2 36640189 missense possibly damaging 0.83
R1954:Olfr345 UTSW 2 36640215 missense possibly damaging 0.86
R2206:Olfr345 UTSW 2 36640189 missense possibly damaging 0.83
R2207:Olfr345 UTSW 2 36640189 missense possibly damaging 0.83
R4470:Olfr345 UTSW 2 36640221 missense probably damaging 1.00
R4583:Olfr345 UTSW 2 36640614 missense probably damaging 1.00
R4744:Olfr345 UTSW 2 36640979 unclassified probably null
R4897:Olfr345 UTSW 2 36640894 missense probably damaging 1.00
R5308:Olfr345 UTSW 2 36640694 nonsense probably null
R5510:Olfr345 UTSW 2 36640963 missense probably benign
R6175:Olfr345 UTSW 2 36640051 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGAACAAGGCATGTACTTTGC -3'
(R):5'- CATTGGCAATGGATAAGGCC -3'

Sequencing Primer
(F):5'- CATGTACCTGACAACTGTGCTGG -3'
(R):5'- TAAGGCCCAGGATACAAGTACTAG -3'
Posted On2015-03-25