Incidental Mutation 'R3773:Csgalnact2'
ID273427
Institutional Source Beutler Lab
Gene Symbol Csgalnact2
Ensembl Gene ENSMUSG00000042042
Gene Namechondroitin sulfate N-acetylgalactosaminyltransferase 2
Synonyms4632415D10Rik, Galnact2
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118107452-118139140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118126219 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 19 (K19E)
Ref Sequence ENSEMBL: ENSMUSP00000116371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049344] [ENSMUST00000136265]
Predicted Effect probably benign
Transcript: ENSMUST00000049344
AA Change: K261E

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039819
Gene: ENSMUSG00000042042
AA Change: K261E

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:CHGN 53 516 3e-83 PFAM
Pfam:Glyco_tranf_2_2 273 477 4.1e-8 PFAM
Pfam:Glyco_transf_7C 413 489 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125531
Predicted Effect probably benign
Transcript: ENSMUST00000136265
AA Change: K19E

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000116371
Gene: ENSMUSG00000042042
AA Change: K19E

DomainStartEndE-ValueType
Pfam:CHGN 2 223 5.8e-45 PFAM
Pfam:Glyco_tranf_2_2 31 223 6.5e-9 PFAM
Pfam:Glyco_transf_7C 170 223 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. The encoded protein is involved in elongation during chondroitin sulfate synthesis. Alternative splicing of this gene results in multiple transcript variants. Two related pseudogenes have been identified on chromosome X. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Stxbp5 G A 10: 9,768,927 T960I probably damaging Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Csgalnact2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Csgalnact2 APN 6 118126272 start codon destroyed probably null 0.88
IGL00955:Csgalnact2 APN 6 118129264 missense probably damaging 1.00
IGL01396:Csgalnact2 APN 6 118126327 missense probably damaging 1.00
IGL01757:Csgalnact2 APN 6 118129346 missense probably damaging 1.00
IGL02687:Csgalnact2 APN 6 118124415 critical splice acceptor site probably null
IGL02833:Csgalnact2 APN 6 118129268 missense probably damaging 1.00
IGL02837:Csgalnact2 UTSW 6 118124403 missense probably benign 0.10
R0206:Csgalnact2 UTSW 6 118114386 missense probably benign 0.13
R0761:Csgalnact2 UTSW 6 118126112 splice site probably benign
R1201:Csgalnact2 UTSW 6 118114432 missense probably damaging 0.98
R2106:Csgalnact2 UTSW 6 118109129 nonsense probably null
R3900:Csgalnact2 UTSW 6 118121014 missense probably damaging 1.00
R5618:Csgalnact2 UTSW 6 118126316 missense probably damaging 0.99
R5682:Csgalnact2 UTSW 6 118120992 missense probably damaging 1.00
R5744:Csgalnact2 UTSW 6 118126236 missense probably damaging 1.00
R5895:Csgalnact2 UTSW 6 118129254 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGCTGAGTAATTATACTTGGTGAAG -3'
(R):5'- TACTTTGGATCCTTGCCTGAG -3'

Sequencing Primer
(F):5'- GGTGAAGATAAATTAAGTGAGTCTGC -3'
(R):5'- GGATCCTTGCCTGAGTGAAATC -3'
Posted On2015-03-25