Incidental Mutation 'R3775:C2cd3'
ID 273550
Institutional Source Beutler Lab
Gene Symbol C2cd3
Ensembl Gene ENSMUSG00000047248
Gene Name C2 calcium-dependent domain containing 3
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3775 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 100021440-100119359 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100081205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 1327 (L1327S)
Ref Sequence ENSEMBL: ENSMUSP00000062637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000120196]
AlphaFold Q52KB6
Predicted Effect probably damaging
Transcript: ENSMUST00000051777
AA Change: L1327S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: L1327S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
low complexity region 2110 2125 N/A INTRINSIC
low complexity region 2180 2197 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098259
AA Change: L1327S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: L1327S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
C2 524 662 2.36e1 SMART
C2 790 899 3.73e0 SMART
C2 989 1129 1.47e1 SMART
C2 1182 1321 1.63e1 SMART
C2 1617 1724 1.43e-2 SMART
low complexity region 1892 1906 N/A INTRINSIC
low complexity region 2037 2049 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119647
AA Change: L949S
SMART Domains Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: L949S

DomainStartEndE-ValueType
C2 61 199 2.36e1 SMART
C2 327 436 3.73e0 SMART
C2 526 666 1.47e1 SMART
C2 719 858 1.63e1 SMART
C2 1154 1261 1.43e-2 SMART
low complexity region 1429 1443 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120196
AA Change: L96S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113728
Gene: ENSMUSG00000047248
AA Change: L96S

DomainStartEndE-ValueType
low complexity region 297 308 N/A INTRINSIC
C2 415 553 1.5e-1 SMART
C2 681 790 2.4e-2 SMART
C2 880 1020 9.5e-2 SMART
C2 1073 1212 1.1e-1 SMART
C2 1508 1615 9e-5 SMART
low complexity region 1783 1797 N/A INTRINSIC
low complexity region 1928 1940 N/A INTRINSIC
low complexity region 2001 2016 N/A INTRINSIC
low complexity region 2071 2087 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185051
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 8,986,387 (GRCm39) E2557G possibly damaging Het
Arid1a A G 4: 133,414,075 (GRCm39) S1248P unknown Het
Ccnh T C 13: 85,354,243 (GRCm39) probably benign Het
Dcdc5 C A 2: 106,202,738 (GRCm39) noncoding transcript Het
Eprs1 T C 1: 185,105,205 (GRCm39) F160S probably damaging Het
F9 A G X: 59,064,345 (GRCm39) I190V probably benign Het
Fam185a C A 5: 21,660,804 (GRCm39) A273D probably damaging Het
Fhod1 G A 8: 106,058,270 (GRCm39) probably benign Het
Gpat4 G A 8: 23,670,171 (GRCm39) P286L probably damaging Het
Hipk2 T C 6: 38,720,029 (GRCm39) D534G probably damaging Het
Ints6l T C X: 55,526,731 (GRCm39) L220S probably damaging Het
Kat7 T C 11: 95,182,357 (GRCm39) T250A probably benign Het
Kif23 G A 9: 61,832,274 (GRCm39) S623L probably benign Het
Krt32 A G 11: 99,978,947 (GRCm39) C36R probably benign Het
Megf10 G A 18: 57,410,177 (GRCm39) G653S probably damaging Het
Mpp3 G T 11: 101,914,193 (GRCm39) S134* probably null Het
Msh6 G T 17: 88,293,609 (GRCm39) R788L probably damaging Het
Mxi1 C A 19: 53,360,160 (GRCm39) A294E probably benign Het
Naip5 T C 13: 100,359,883 (GRCm39) E451G probably benign Het
Naip5 T C 13: 100,359,902 (GRCm39) I445V probably benign Het
Nlrp1b T C 11: 71,047,126 (GRCm39) probably benign Het
Npy1r T C 8: 67,157,502 (GRCm39) F271L possibly damaging Het
Nup160 G T 2: 90,552,420 (GRCm39) C1132F probably benign Het
Or13p3 C T 4: 118,567,351 (GRCm39) T249I probably damaging Het
Or1o2 T A 17: 37,543,121 (GRCm39) I47F probably damaging Het
Pcdhga5 A G 18: 37,828,167 (GRCm39) E205G possibly damaging Het
Pdgfc A G 3: 81,048,858 (GRCm39) T89A probably damaging Het
Pecr A G 1: 72,298,530 (GRCm39) F297L probably benign Het
Pgr15l G T X: 96,120,747 (GRCm39) R181M probably damaging Het
Pomgnt1 G A 4: 116,011,325 (GRCm39) R230H probably damaging Het
Ppm1d T C 11: 85,227,993 (GRCm39) I303T probably damaging Het
Ptprc T G 1: 137,992,511 (GRCm39) Q1205H probably damaging Het
Rnf112 A T 11: 61,341,011 (GRCm39) probably benign Het
Slc25a13 T A 6: 6,109,288 (GRCm39) Q358L probably damaging Het
Slc25a19 A G 11: 115,506,285 (GRCm39) Y303H probably damaging Het
Sympk T C 7: 18,769,880 (GRCm39) F186L probably damaging Het
Tek A G 4: 94,692,549 (GRCm39) D219G probably benign Het
Tmem59l A G 8: 70,939,951 (GRCm39) L6S unknown Het
Tnik T C 3: 28,692,568 (GRCm39) Y820H probably damaging Het
Tnrc6c C T 11: 117,614,355 (GRCm39) R838W probably damaging Het
Vmn2r29 C G 7: 7,243,011 (GRCm39) D500H probably damaging Het
Other mutations in C2cd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:C2cd3 APN 7 100,040,335 (GRCm39) missense probably benign 0.14
IGL01420:C2cd3 APN 7 100,104,065 (GRCm39) missense probably benign 0.35
IGL01775:C2cd3 APN 7 100,092,638 (GRCm39) missense probably damaging 1.00
IGL01832:C2cd3 APN 7 100,076,421 (GRCm39) missense possibly damaging 0.94
IGL01883:C2cd3 APN 7 100,023,693 (GRCm39) missense possibly damaging 0.80
IGL02664:C2cd3 APN 7 100,068,922 (GRCm39) missense possibly damaging 0.67
IGL02697:C2cd3 APN 7 100,076,376 (GRCm39) unclassified probably benign
IGL02852:C2cd3 APN 7 100,079,396 (GRCm39) missense probably damaging 1.00
IGL03158:C2cd3 APN 7 100,023,683 (GRCm39) missense probably damaging 1.00
R0012:C2cd3 UTSW 7 100,067,729 (GRCm39) missense possibly damaging 0.52
R0012:C2cd3 UTSW 7 100,067,729 (GRCm39) missense possibly damaging 0.52
R0013:C2cd3 UTSW 7 100,065,269 (GRCm39) missense probably damaging 1.00
R0013:C2cd3 UTSW 7 100,065,269 (GRCm39) missense probably damaging 1.00
R0032:C2cd3 UTSW 7 100,093,652 (GRCm39) unclassified probably benign
R0032:C2cd3 UTSW 7 100,093,652 (GRCm39) unclassified probably benign
R0124:C2cd3 UTSW 7 100,118,725 (GRCm39) missense probably benign
R0387:C2cd3 UTSW 7 100,071,714 (GRCm39) splice site probably benign
R0522:C2cd3 UTSW 7 100,044,429 (GRCm39) missense probably benign 0.14
R1124:C2cd3 UTSW 7 100,071,888 (GRCm39) missense probably benign 0.00
R1484:C2cd3 UTSW 7 100,089,397 (GRCm39) missense probably damaging 1.00
R1533:C2cd3 UTSW 7 100,055,284 (GRCm39) missense possibly damaging 0.54
R1631:C2cd3 UTSW 7 100,021,704 (GRCm39) critical splice donor site probably null
R1875:C2cd3 UTSW 7 100,056,232 (GRCm39) missense possibly damaging 0.89
R2059:C2cd3 UTSW 7 100,104,700 (GRCm39) unclassified probably benign
R2060:C2cd3 UTSW 7 100,104,155 (GRCm39) missense probably damaging 1.00
R2348:C2cd3 UTSW 7 100,062,573 (GRCm39) missense probably damaging 1.00
R3103:C2cd3 UTSW 7 100,044,459 (GRCm39) missense possibly damaging 0.47
R3405:C2cd3 UTSW 7 100,039,373 (GRCm39) missense probably benign 0.01
R3687:C2cd3 UTSW 7 100,085,040 (GRCm39) missense probably benign 0.28
R3854:C2cd3 UTSW 7 100,103,808 (GRCm39) critical splice acceptor site probably null
R4359:C2cd3 UTSW 7 100,090,296 (GRCm39) missense probably damaging 1.00
R4403:C2cd3 UTSW 7 100,081,306 (GRCm39) missense probably damaging 1.00
R4446:C2cd3 UTSW 7 100,023,684 (GRCm39) missense probably damaging 1.00
R4646:C2cd3 UTSW 7 100,021,657 (GRCm39) unclassified probably benign
R4705:C2cd3 UTSW 7 100,044,395 (GRCm39) missense possibly damaging 0.77
R4770:C2cd3 UTSW 7 100,092,642 (GRCm39) missense probably damaging 1.00
R4777:C2cd3 UTSW 7 100,065,539 (GRCm39) missense possibly damaging 0.46
R4816:C2cd3 UTSW 7 100,040,226 (GRCm39) missense probably benign 0.01
R4842:C2cd3 UTSW 7 100,065,397 (GRCm39) missense probably benign 0.00
R4858:C2cd3 UTSW 7 100,104,160 (GRCm39) missense probably damaging 1.00
R4871:C2cd3 UTSW 7 100,062,581 (GRCm39) missense possibly damaging 0.79
R4898:C2cd3 UTSW 7 100,055,166 (GRCm39) missense probably damaging 1.00
R5026:C2cd3 UTSW 7 100,109,049 (GRCm39) missense possibly damaging 0.52
R5112:C2cd3 UTSW 7 100,092,692 (GRCm39) missense possibly damaging 0.91
R5242:C2cd3 UTSW 7 100,039,373 (GRCm39) missense probably benign 0.01
R5538:C2cd3 UTSW 7 100,104,700 (GRCm39) critical splice donor site probably null
R5861:C2cd3 UTSW 7 100,093,682 (GRCm39) unclassified probably benign
R6110:C2cd3 UTSW 7 100,090,283 (GRCm39) missense probably damaging 1.00
R6326:C2cd3 UTSW 7 100,065,635 (GRCm39) missense probably benign 0.02
R6429:C2cd3 UTSW 7 100,081,298 (GRCm39) missense probably damaging 1.00
R6610:C2cd3 UTSW 7 100,104,505 (GRCm39) missense probably benign
R6613:C2cd3 UTSW 7 100,044,448 (GRCm39) missense possibly damaging 0.87
R6631:C2cd3 UTSW 7 100,067,747 (GRCm39) missense probably damaging 1.00
R6787:C2cd3 UTSW 7 100,104,553 (GRCm39) missense probably benign
R6837:C2cd3 UTSW 7 100,097,953 (GRCm39) missense probably damaging 1.00
R6849:C2cd3 UTSW 7 100,056,134 (GRCm39) missense probably damaging 1.00
R6860:C2cd3 UTSW 7 100,039,448 (GRCm39) missense probably benign 0.28
R6929:C2cd3 UTSW 7 100,100,826 (GRCm39) missense probably damaging 1.00
R7026:C2cd3 UTSW 7 100,081,299 (GRCm39) missense probably damaging 1.00
R7088:C2cd3 UTSW 7 100,065,388 (GRCm39) missense
R7174:C2cd3 UTSW 7 100,081,405 (GRCm39) missense
R7241:C2cd3 UTSW 7 100,056,257 (GRCm39) missense
R7335:C2cd3 UTSW 7 100,071,810 (GRCm39) missense
R7357:C2cd3 UTSW 7 100,079,310 (GRCm39) missense
R7493:C2cd3 UTSW 7 100,076,433 (GRCm39) missense
R7567:C2cd3 UTSW 7 100,080,022 (GRCm39) missense
R7573:C2cd3 UTSW 7 100,068,914 (GRCm39) missense
R7869:C2cd3 UTSW 7 100,118,698 (GRCm39) missense probably damaging 0.99
R7999:C2cd3 UTSW 7 100,109,096 (GRCm39) critical splice donor site probably null
R8134:C2cd3 UTSW 7 100,067,711 (GRCm39) missense
R8369:C2cd3 UTSW 7 100,044,465 (GRCm39) missense probably benign 0.03
R8372:C2cd3 UTSW 7 100,104,487 (GRCm39) nonsense probably null
R8753:C2cd3 UTSW 7 100,049,024 (GRCm39) critical splice donor site probably null
R8893:C2cd3 UTSW 7 100,104,004 (GRCm39) missense probably benign
R8905:C2cd3 UTSW 7 100,074,132 (GRCm39) critical splice donor site probably null
R8945:C2cd3 UTSW 7 100,040,286 (GRCm39) missense possibly damaging 0.88
R8970:C2cd3 UTSW 7 100,068,971 (GRCm39) missense
R9000:C2cd3 UTSW 7 100,065,281 (GRCm39) missense
R9064:C2cd3 UTSW 7 100,059,608 (GRCm39) missense
R9072:C2cd3 UTSW 7 100,040,291 (GRCm39) missense probably benign 0.07
R9126:C2cd3 UTSW 7 100,081,430 (GRCm39) missense
R9160:C2cd3 UTSW 7 100,075,236 (GRCm39) missense
R9234:C2cd3 UTSW 7 100,049,012 (GRCm39) missense
R9258:C2cd3 UTSW 7 100,098,026 (GRCm39) missense
R9295:C2cd3 UTSW 7 100,081,734 (GRCm39) missense
R9411:C2cd3 UTSW 7 100,065,704 (GRCm39) missense
R9420:C2cd3 UTSW 7 100,065,262 (GRCm39) missense
R9589:C2cd3 UTSW 7 100,081,756 (GRCm39) missense
R9628:C2cd3 UTSW 7 100,097,961 (GRCm39) missense
R9629:C2cd3 UTSW 7 100,029,249 (GRCm39) missense probably damaging 1.00
R9681:C2cd3 UTSW 7 100,023,662 (GRCm39) missense probably benign 0.32
R9775:C2cd3 UTSW 7 100,076,458 (GRCm39) missense
X0002:C2cd3 UTSW 7 100,089,442 (GRCm39) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCTCAGTGGTCAGAGGAACG -3'
(R):5'- CTTTCTTGACAAGATCCTTTGGG -3'

Sequencing Primer
(F):5'- GAACTCACTCTATAGTCCAGGCTGG -3'
(R):5'- TGGGATGCTCTCAAAGCT -3'
Posted On 2015-03-25