Incidental Mutation 'R3775:Krt32'
ID273559
Institutional Source Beutler Lab
Gene Symbol Krt32
Ensembl Gene ENSMUSG00000046095
Gene Namekeratin 32
SynonymsmHa2, Krt1-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3775 (G1)
Quality Score224
Status Validated
Chromosome11
Chromosomal Location100080848-100088226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100088121 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 36 (C36R)
Ref Sequence ENSEMBL: ENSMUSP00000103042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103127] [ENSMUST00000107419]
Predicted Effect probably benign
Transcript: ENSMUST00000103127
SMART Domains Protein: ENSMUSP00000099416
Gene: ENSMUSG00000048013

DomainStartEndE-ValueType
low complexity region 33 43 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
Filament 96 407 3.32e-159 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107419
AA Change: C36R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103042
Gene: ENSMUSG00000046095
AA Change: C36R

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
Filament 100 411 5.4e-150 SMART
low complexity region 435 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173988
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,009,023 E2557G possibly damaging Het
Arid1a A G 4: 133,686,764 S1248P unknown Het
C2cd3 T C 7: 100,431,998 L1327S probably damaging Het
Ccnh T C 13: 85,206,124 probably benign Het
Dcdc5 C A 2: 106,372,393 noncoding transcript Het
Eprs T C 1: 185,373,008 F160S probably damaging Het
F9 A G X: 60,018,985 I190V probably benign Het
Fam185a C A 5: 21,455,806 A273D probably damaging Het
Fhod1 G A 8: 105,331,638 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hipk2 T C 6: 38,743,094 D534G probably damaging Het
Ints6l T C X: 56,481,371 L220S probably damaging Het
Kat7 T C 11: 95,291,531 T250A probably benign Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nlrp1b T C 11: 71,156,300 probably benign Het
Npy1r T C 8: 66,704,850 F271L possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1341 C T 4: 118,710,154 T249I probably damaging Het
Olfr97 T A 17: 37,232,230 I47F probably damaging Het
Pcdhga5 A G 18: 37,695,114 E205G possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Pgr15l G T X: 97,077,141 R181M probably damaging Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rnf112 A T 11: 61,450,185 probably benign Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Slc25a19 A G 11: 115,615,459 Y303H probably damaging Het
Sympk T C 7: 19,035,955 F186L probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn2r29 C G 7: 7,240,012 D500H probably damaging Het
Other mutations in Krt32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Krt32 APN 11 100087779 missense probably benign 0.23
IGL01454:Krt32 APN 11 100084081 missense probably damaging 1.00
IGL02268:Krt32 APN 11 100088141 missense probably benign 0.21
IGL02502:Krt32 APN 11 100087923 missense probably damaging 1.00
IGL02967:Krt32 APN 11 100084050 missense possibly damaging 0.93
IGL02799:Krt32 UTSW 11 100087907 missense possibly damaging 0.54
R0840:Krt32 UTSW 11 100081242 missense probably benign 0.00
R1503:Krt32 UTSW 11 100084110 critical splice acceptor site probably null
R1944:Krt32 UTSW 11 100084844 critical splice acceptor site probably null
R1945:Krt32 UTSW 11 100084844 critical splice acceptor site probably null
R2426:Krt32 UTSW 11 100086366 missense possibly damaging 0.76
R3774:Krt32 UTSW 11 100088121 missense probably benign 0.00
R3776:Krt32 UTSW 11 100088121 missense probably benign 0.00
R5522:Krt32 UTSW 11 100086671 critical splice donor site probably null
R5794:Krt32 UTSW 11 100084986 missense probably damaging 0.99
R6109:Krt32 UTSW 11 100087965 missense probably benign 0.01
R6994:Krt32 UTSW 11 100086445 missense probably damaging 1.00
Z1088:Krt32 UTSW 11 100088216 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTGAAGGCACCCTCACAG -3'
(R):5'- AGAATACTTTAGTGCGAACCCC -3'

Sequencing Primer
(F):5'- GAACAGGCCATAGGTCCCCATG -3'
(R):5'- GAATACTTTAGTGCGAACCCCTTCAC -3'
Posted On2015-03-25