Incidental Mutation 'R3775:Slc25a19'
ID273561
Institutional Source Beutler Lab
Gene Symbol Slc25a19
Ensembl Gene ENSMUSG00000020744
Gene Namesolute carrier family 25 (mitochondrial thiamine pyrophosphate carrier), member 19
Synonyms2900089E13Rik, DNC, MUP1, TPC
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3775 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115614178-115628295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115615459 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 303 (Y303H)
Ref Sequence ENSEMBL: ENSMUSP00000137534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021087] [ENSMUST00000021089] [ENSMUST00000106503] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000135552] [ENSMUST00000148574] [ENSMUST00000178003]
Predicted Effect probably benign
Transcript: ENSMUST00000021087
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021089
AA Change: Y303H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021089
Gene: ENSMUSG00000020744
AA Change: Y303H

DomainStartEndE-ValueType
Pfam:Mito_carr 12 111 5.7e-20 PFAM
Pfam:Mito_carr 114 205 5.3e-24 PFAM
Pfam:Mito_carr 212 313 5.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106503
SMART Domains Protein: ENSMUSP00000102112
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.7e-22 PFAM
Pfam:Mito_carr 114 172 9.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106506
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106507
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129194
Predicted Effect probably damaging
Transcript: ENSMUST00000135552
AA Change: Y220H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114566
Gene: ENSMUSG00000020744
AA Change: Y220H

DomainStartEndE-ValueType
Pfam:Mito_carr 31 122 1.1e-25 PFAM
Pfam:Mito_carr 129 226 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146244
Predicted Effect probably benign
Transcript: ENSMUST00000148574
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178003
AA Change: Y303H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137534
Gene: ENSMUSG00000020744
AA Change: Y303H

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.1e-21 PFAM
Pfam:Mito_carr 114 205 7e-25 PFAM
Pfam:Mito_carr 212 313 1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180919
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial protein that is a member of the solute carrier family. Although this protein was initially thought to be the mitochondrial deoxynucleotide carrier involved in the uptake of deoxynucleotides into the matrix of the mitochondria, further studies have demonstrated that this protein instead functions as the mitochondrial thiamine pyrophosphate carrier, which transports thiamine pyrophosphates into mitochondria. Mutations in this gene cause microcephaly, Amish type, a metabolic disease that results in severe congenital microcephaly, severe 2-ketoglutaric aciduria, and death within the first year. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality by E12, neural tube closure defects resulting in exencephaly and microcephaly, growth arrest, anemia, elevated alpha-ketoglutarate in amniotic fluid, and reduced thiamine pyrophosphate content in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,009,023 E2557G possibly damaging Het
Arid1a A G 4: 133,686,764 S1248P unknown Het
C2cd3 T C 7: 100,431,998 L1327S probably damaging Het
Ccnh T C 13: 85,206,124 probably benign Het
Dcdc5 C A 2: 106,372,393 noncoding transcript Het
Eprs T C 1: 185,373,008 F160S probably damaging Het
F9 A G X: 60,018,985 I190V probably benign Het
Fam185a C A 5: 21,455,806 A273D probably damaging Het
Fhod1 G A 8: 105,331,638 probably benign Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Hipk2 T C 6: 38,743,094 D534G probably damaging Het
Ints6l T C X: 56,481,371 L220S probably damaging Het
Kat7 T C 11: 95,291,531 T250A probably benign Het
Kif23 G A 9: 61,924,992 S623L probably benign Het
Krt32 A G 11: 100,088,121 C36R probably benign Het
Megf10 G A 18: 57,277,105 G653S probably damaging Het
Mpp3 G T 11: 102,023,367 S134* probably null Het
Msh6 G T 17: 87,986,181 R788L probably damaging Het
Mxi1 C A 19: 53,371,729 A294E probably benign Het
Naip5 T C 13: 100,223,375 E451G probably benign Het
Naip5 T C 13: 100,223,394 I445V probably benign Het
Nlrp1b T C 11: 71,156,300 probably benign Het
Npy1r T C 8: 66,704,850 F271L possibly damaging Het
Nup160 G T 2: 90,722,076 C1132F probably benign Het
Olfr1341 C T 4: 118,710,154 T249I probably damaging Het
Olfr97 T A 17: 37,232,230 I47F probably damaging Het
Pcdhga5 A G 18: 37,695,114 E205G possibly damaging Het
Pdgfc A G 3: 81,141,551 T89A probably damaging Het
Pecr A G 1: 72,259,371 F297L probably benign Het
Pgr15l G T X: 97,077,141 R181M probably damaging Het
Pomgnt1 G A 4: 116,154,128 R230H probably damaging Het
Ppm1d T C 11: 85,337,167 I303T probably damaging Het
Ptprc T G 1: 138,064,773 Q1205H probably damaging Het
Rnf112 A T 11: 61,450,185 probably benign Het
Slc25a13 T A 6: 6,109,288 Q358L probably damaging Het
Sympk T C 7: 19,035,955 F186L probably damaging Het
Tek A G 4: 94,804,312 D219G probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tnik T C 3: 28,638,419 Y820H probably damaging Het
Tnrc6c C T 11: 117,723,529 R838W probably damaging Het
Vmn2r29 C G 7: 7,240,012 D500H probably damaging Het
Other mutations in Slc25a19
AlleleSourceChrCoordTypePredicted EffectPPH Score
Baggins UTSW 11 115617560 missense possibly damaging 0.91
PIT4498001:Slc25a19 UTSW 11 115623955 missense possibly damaging 0.80
R0335:Slc25a19 UTSW 11 115624206 missense probably damaging 1.00
R0398:Slc25a19 UTSW 11 115617575 missense probably damaging 1.00
R0454:Slc25a19 UTSW 11 115617597 nonsense probably null
R1614:Slc25a19 UTSW 11 115616623 nonsense probably null
R3776:Slc25a19 UTSW 11 115615459 missense probably damaging 1.00
R5000:Slc25a19 UTSW 11 115616671 intron probably null
R5593:Slc25a19 UTSW 11 115616592 missense probably damaging 1.00
R5738:Slc25a19 UTSW 11 115624234 missense probably benign 0.24
R6167:Slc25a19 UTSW 11 115615551 missense probably benign 0.14
R6306:Slc25a19 UTSW 11 115617560 missense possibly damaging 0.91
R7014:Slc25a19 UTSW 11 115620966 missense probably damaging 1.00
R7161:Slc25a19 UTSW 11 115616547 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTCAGCTCCGGATGACTTCATG -3'
(R):5'- TTAGAAAGAGTGAGGAGCTCCC -3'

Sequencing Primer
(F):5'- GATGACTTCATGCTCCCGG -3'
(R):5'- CAGGCAGTTACAGGAGCTGC -3'
Posted On2015-03-25