Incidental Mutation 'R2118:Cnih2'
ID273636
Institutional Source Beutler Lab
Gene Symbol Cnih2
Ensembl Gene ENSMUSG00000024873
Gene Namecornichon family AMPA receptor auxiliary protein 2
SynonymsCnil
MMRRC Submission 040122-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R2118 (G1)
Quality Score27
Status Validated
Chromosome19
Chromosomal Location5092871-5098418 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5098248 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 6 (A6S)
Ref Sequence ENSEMBL: ENSMUSP00000025805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025804] [ENSMUST00000025805]
Predicted Effect probably benign
Transcript: ENSMUST00000025804
SMART Domains Protein: ENSMUSP00000025804
Gene: ENSMUSG00000024870

DomainStartEndE-ValueType
RAB 9 172 4.57e-105 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025805
AA Change: A6S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025805
Gene: ENSMUSG00000024873
AA Change: A6S

DomainStartEndE-ValueType
Pfam:Cornichon 7 151 5.3e-37 PFAM
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene encodes a protein that is an auxiliary subunit of the ionotropic glutamate receptor of the AMPA subtype. This protein is similar to a Drosophila protein involved in anterior-posterior and dorsal-ventral patterning. Cnih2 conditional knockout mice exhibit reduced AMPA receptor synaptic transmission in the hippocampus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L24Rik T C 11: 83,440,364 S31P possibly damaging Het
4933430I17Rik T A 4: 62,538,872 L143M possibly damaging Het
Abca13 T C 11: 9,309,013 probably benign Het
Abcg5 T A 17: 84,671,147 E294D probably benign Het
Abi3bp T C 16: 56,477,864 probably benign Het
Adamts8 T C 9: 30,943,063 F76S probably damaging Het
Agpat3 T C 10: 78,278,084 R257G probably damaging Het
Ahctf1 C A 1: 179,769,452 R43L probably damaging Het
AI593442 T C 9: 52,677,693 T195A probably benign Het
Aipl1 A T 11: 72,029,369 L291Q possibly damaging Het
Ambn T A 5: 88,460,758 probably benign Het
Arap2 G A 5: 62,706,685 T532I probably damaging Het
Arg1 T C 10: 24,920,723 N69D possibly damaging Het
Arhgef10 A G 8: 14,934,820 D200G probably damaging Het
Arhgef38 T C 3: 133,160,753 K208E probably benign Het
Asb4 A T 6: 5,390,687 T27S probably benign Het
Ash1l C G 3: 88,985,295 Q1494E possibly damaging Het
Car12 T C 9: 66,713,892 V15A probably benign Het
Cdc20b A G 13: 113,078,698 I267V probably benign Het
Cdh1 A G 8: 106,664,210 I653V probably benign Het
Cenpe T A 3: 135,246,884 M1445K possibly damaging Het
Cfap43 T C 19: 47,770,438 E932G probably damaging Het
Cfhr1 G C 1: 139,550,904 Q243E probably benign Het
Cntnap1 G T 11: 101,188,657 M1240I probably benign Het
Cntrl T C 2: 35,161,965 S1050P probably benign Het
Cyp2a12 A G 7: 27,036,646 *493W probably null Het
Dbx2 A C 15: 95,624,800 L342R probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dnajb2 T C 1: 75,237,477 W30R probably damaging Het
Ecel1 A G 1: 87,148,275 S727P probably damaging Het
Ednrb T A 14: 103,821,768 D274V probably benign Het
Fam78b G A 1: 167,078,709 V146M probably damaging Het
Fancd2 A G 6: 113,560,074 probably benign Het
Fbxw14 T C 9: 109,274,624 probably benign Het
Gimap4 G T 6: 48,690,971 C92F probably benign Het
Gm5828 A G 1: 16,769,975 noncoding transcript Het
Gnpat T C 8: 124,876,941 V186A probably damaging Het
Gnptab T C 10: 88,436,398 S967P probably benign Het
Ikbkb T C 8: 22,667,217 probably benign Het
Il1rap A T 16: 26,710,565 H379L probably damaging Het
Ints12 T C 3: 133,109,160 V376A probably damaging Het
Kalrn C T 16: 34,332,230 S309N possibly damaging Het
Kel T A 6: 41,689,300 I471L probably benign Het
Klhl25 T C 7: 75,866,732 V462A probably damaging Het
Ksr1 A T 11: 79,045,193 M77K probably benign Het
Leo1 T A 9: 75,445,812 N212K probably damaging Het
Ltbp1 T A 17: 75,310,159 V1031E possibly damaging Het
Ltbr A G 6: 125,309,477 S249P probably benign Het
Mast4 A G 13: 102,754,205 V855A probably damaging Het
Mdga2 T A 12: 66,868,752 E43V probably damaging Het
Mmaa A T 8: 79,267,959 L406* probably null Het
Nlrp12 A T 7: 3,241,449 N144K probably damaging Het
Nlrp6 T C 7: 140,926,444 V766A probably benign Het
Olfr1314 C A 2: 112,092,330 V124L probably benign Het
Olfr186 A G 16: 59,027,815 F31L possibly damaging Het
Pabpc4l T C 3: 46,446,841 T123A probably benign Het
Pappa2 T C 1: 158,857,266 T768A probably damaging Het
Pde6d A G 1: 86,545,802 F91L probably benign Het
Ppp1r13l A G 7: 19,371,421 M373V possibly damaging Het
Prss37 G A 6: 40,515,360 R186* probably null Het
Psg16 C A 7: 17,090,623 H111N probably benign Het
Psg20 T A 7: 18,681,022 Y316F probably benign Het
Psmd1 T A 1: 86,078,700 S263T possibly damaging Het
Rai14 A G 15: 10,575,166 F569L probably benign Het
Rbpms2 T A 9: 65,650,947 D116E probably damaging Het
Rgs20 A G 1: 4,916,890 probably benign Het
Rnf114 T C 2: 167,510,883 L101P probably damaging Het
Rnf168 T G 16: 32,278,218 L37R probably damaging Het
RP23-114B10.6 A C 8: 69,372,290 noncoding transcript Het
Rpe T C 1: 66,715,228 M153T probably damaging Het
Sap18 T A 14: 57,798,554 S66T probably damaging Het
Slc2a13 A G 15: 91,516,476 V181A probably damaging Het
Soga1 T C 2: 157,033,325 E835G probably damaging Het
Spag17 A G 3: 100,049,240 E884G possibly damaging Het
Sycn T C 7: 28,541,288 S127P probably damaging Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tas2r117 T A 6: 132,803,166 I89K probably damaging Het
Tep1 C A 14: 50,855,572 probably null Het
Tex14 T C 11: 87,519,743 probably benign Het
Tll1 T C 8: 64,085,557 E351G probably benign Het
Tmem44 T A 16: 30,547,444 K55* probably null Het
Trak1 T A 9: 121,472,997 *940R probably null Het
Vmn1r200 C T 13: 22,395,183 T43I probably damaging Het
Wars2 T C 3: 99,216,567 V248A probably benign Het
Wfdc6b C T 2: 164,617,443 R142C probably benign Het
Zfp729a A T 13: 67,621,494 probably null Het
Zfp759 C A 13: 67,139,514 probably benign Het
Other mutations in Cnih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Cnih2 APN 19 5098273 utr 5 prime probably benign
R1469:Cnih2 UTSW 19 5093702 missense probably damaging 1.00
R1469:Cnih2 UTSW 19 5093702 missense probably damaging 1.00
R1797:Cnih2 UTSW 19 5094286 missense probably benign 0.17
R4976:Cnih2 UTSW 19 5093929 unclassified probably null
X0065:Cnih2 UTSW 19 5093804 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCAAGTTTCCCCGGAGCAC -3'
(R):5'- AAACACTGGGCTCATTGGG -3'

Sequencing Primer
(F):5'- AGTTTCCCCGGAGCACTGATAC -3'
(R):5'- TCTGAGTCTCAGCCCCG -3'
Posted On2015-03-31