Mutagenetix > Incidental Mutation

Incidental Mutation 'R3499:Kif13a'

273717

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

040662-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R3499 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46902563-47083343 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46978815 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 195 (D195G)

Ref Sequence

ENSEMBL: ENSMUSP00000055304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000056978
AA Change: D195G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: D195G

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000225591
AA Change: D132G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Meta Mutation Damage Score

0.7533

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.7%
20x: 96.3%

Validation Efficiency

100% (46/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430571L13Rik	A	T	9: 107,219,678 (GRCm39)	T44S	probably damaging	Het
Cass4	C	T	2: 172,274,478 (GRCm39)	P753L	probably damaging	Het
Cimip3	AC	A	17: 47,744,348 (GRCm39)		probably benign	Het
Ctif	A	T	18: 75,744,828 (GRCm39)	L92Q	possibly damaging	Het
Dnah11	C	A	12: 117,874,758 (GRCm39)	D4036Y	probably damaging	Het
Dnah17	C	T	11: 117,971,675 (GRCm39)		probably benign	Het
Dnah6	G	C	6: 73,009,616 (GRCm39)	A3725G	probably benign	Het
Ebag9	A	G	15: 44,493,528 (GRCm39)	N117D	probably benign	Het
Elf4	C	T	X: 47,507,942 (GRCm39)	E158K	probably benign	Het
Ephb6	C	T	6: 41,593,093 (GRCm39)	R444*	probably null	Het
Fcgbpl1	T	A	7: 27,853,980 (GRCm39)	I1648K	probably benign	Het
Fndc1	C	T	17: 7,972,416 (GRCm39)	M1505I	possibly damaging	Het
Gpr35	A	G	1: 92,911,113 (GRCm39)	Y275C	probably damaging	Het
Hmcn1	A	T	1: 150,480,853 (GRCm39)	I4441N	probably damaging	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Ksr2	C	A	5: 117,827,640 (GRCm39)	T473K	probably damaging	Het
Kxd1	T	C	8: 70,966,632 (GRCm39)		probably null	Het
Lyplal1	A	G	1: 185,820,857 (GRCm39)	S197P	possibly damaging	Het
Macf1	A	T	4: 123,421,098 (GRCm39)	L52*	probably null	Het
Mrgprb5	A	G	7: 47,818,661 (GRCm39)	S25P	probably benign	Het
Nucb1	T	C	7: 45,148,300 (GRCm39)	H171R	probably benign	Het
Or10d1c	A	G	9: 38,893,761 (GRCm39)	L193P	probably damaging	Het
Or4a15	A	T	2: 89,193,294 (GRCm39)	F160I	probably benign	Het
Or56b35	G	A	7: 104,963,607 (GRCm39)	C132Y	probably damaging	Het
Or8h8	A	G	2: 86,753,373 (GRCm39)	F168L	possibly damaging	Het
Or8k18	A	G	2: 86,085,185 (GRCm39)	M284T	possibly damaging	Het
Prkdc	A	T	16: 15,585,889 (GRCm39)	I2476F	probably damaging	Het
Ptprf	A	T	4: 118,082,127 (GRCm39)	I1037N	probably damaging	Het
Ralgapa1	T	G	12: 55,741,928 (GRCm39)		probably benign	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,169,203 (GRCm39)		probably benign	Het
Sla2	G	A	2: 156,717,862 (GRCm39)	R137C	probably damaging	Het
Slc28a3	C	T	13: 58,721,253 (GRCm39)		probably benign	Het
Slc44a4	A	G	17: 35,140,656 (GRCm39)	D283G	probably benign	Het
Slc6a9	A	G	4: 117,714,000 (GRCm39)	I105V	probably benign	Het
Smgc	A	G	15: 91,726,206 (GRCm39)	T51A	possibly damaging	Het
Smyd5	T	A	6: 85,415,172 (GRCm39)	L60H	probably damaging	Het
Spred1	A	T	2: 117,005,867 (GRCm39)	M210L	probably benign	Het
Syne2	G	A	12: 76,101,752 (GRCm39)		probably null	Het
Tab3	T	C	X: 84,658,727 (GRCm39)	I418T	probably benign	Het
Tbc1d12	A	T	19: 38,884,478 (GRCm39)	E343V	possibly damaging	Het
Tktl2	T	A	8: 66,965,897 (GRCm39)	I485N	probably damaging	Het
Tmem181a	T	A	17: 6,330,894 (GRCm39)	Y51*	probably null	Het
Tmem229b-ps	C	T	10: 53,351,223 (GRCm39)		noncoding transcript	Het
Trip11	A	G	12: 101,859,953 (GRCm39)	I307T	possibly damaging	Het
Ttf1	T	C	2: 28,955,499 (GRCm39)	S288P	possibly damaging	Het
Zfp395	G	T	14: 65,628,742 (GRCm39)	R198L	possibly damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46,904,110 (GRCm39)	splice site	probably benign
IGL01433:Kif13a	APN	13	46,926,384 (GRCm39)	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	47,018,313 (GRCm39)	splice site	probably benign
IGL01536:Kif13a	APN	13	46,905,765 (GRCm39)	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	47,018,296 (GRCm39)	missense	probably benign
IGL02020:Kif13a	APN	13	46,947,495 (GRCm39)	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46,925,011 (GRCm39)	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46,978,698 (GRCm39)	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46,938,769 (GRCm39)	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46,938,772 (GRCm39)	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46,926,314 (GRCm39)	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46,905,564 (GRCm39)	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46,918,099 (GRCm39)	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46,939,987 (GRCm39)	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46,978,823 (GRCm39)	splice site	probably benign
R0106:Kif13a	UTSW	13	46,978,823 (GRCm39)	splice site	probably benign
R0135:Kif13a	UTSW	13	46,947,419 (GRCm39)	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46,918,079 (GRCm39)	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46,944,827 (GRCm39)	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46,967,695 (GRCm39)	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46,944,877 (GRCm39)	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46,966,218 (GRCm39)	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46,956,187 (GRCm39)	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46,932,364 (GRCm39)	unclassified	probably benign
R0654:Kif13a	UTSW	13	46,966,218 (GRCm39)	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	47,001,813 (GRCm39)	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46,952,689 (GRCm39)	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46,966,299 (GRCm39)	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46,967,712 (GRCm39)	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	47,082,735 (GRCm39)	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46,978,711 (GRCm39)	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46,944,987 (GRCm39)	splice site	probably benign
R1449:Kif13a	UTSW	13	46,966,212 (GRCm39)	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	47,083,088 (GRCm39)	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46,962,689 (GRCm39)	missense	probably benign
R1579:Kif13a	UTSW	13	46,906,332 (GRCm39)	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46,947,398 (GRCm39)	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46,947,398 (GRCm39)	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46,951,885 (GRCm39)	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46,927,154 (GRCm39)	missense	possibly damaging	0.50
R1755:Kif13a	UTSW	13	46,906,089 (GRCm39)	missense	possibly damaging	0.73
R1858:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R1891:Kif13a	UTSW	13	47,082,695 (GRCm39)	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46,941,638 (GRCm39)	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46,966,221 (GRCm39)	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R1961:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R2016:Kif13a	UTSW	13	46,964,275 (GRCm39)	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46,905,945 (GRCm39)	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46,922,652 (GRCm39)	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46,930,573 (GRCm39)	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46,967,676 (GRCm39)	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46,918,072 (GRCm39)	splice site	probably benign
R3905:Kif13a	UTSW	13	46,956,166 (GRCm39)	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46,967,631 (GRCm39)	splice site	probably null
R4771:Kif13a	UTSW	13	46,978,687 (GRCm39)	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46,980,224 (GRCm39)	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	47,083,075 (GRCm39)	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46,962,531 (GRCm39)	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46,906,222 (GRCm39)	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46,930,639 (GRCm39)	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46,941,561 (GRCm39)	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46,956,122 (GRCm39)	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46,906,197 (GRCm39)	missense	probably benign
R5329:Kif13a	UTSW	13	46,928,877 (GRCm39)	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46,926,245 (GRCm39)	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46,986,212 (GRCm39)	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46,905,591 (GRCm39)	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46,906,338 (GRCm39)	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46,978,776 (GRCm39)	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46,925,000 (GRCm39)	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46,954,789 (GRCm39)	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46,980,233 (GRCm39)	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46,968,683 (GRCm39)	splice site	probably null
R6393:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46,906,222 (GRCm39)	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46,962,632 (GRCm39)	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46,980,221 (GRCm39)	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46,904,089 (GRCm39)	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46,951,955 (GRCm39)	missense	probably benign
R8098:Kif13a	UTSW	13	46,968,780 (GRCm39)	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46,932,444 (GRCm39)	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46,906,057 (GRCm39)	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46,914,813 (GRCm39)	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46,984,279 (GRCm39)	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46,954,921 (GRCm39)	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46,927,154 (GRCm39)	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46,951,841 (GRCm39)	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46,944,941 (GRCm39)	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46,941,536 (GRCm39)	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46,905,934 (GRCm39)	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46,966,263 (GRCm39)	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46,928,909 (GRCm39)	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46,951,838 (GRCm39)	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46,962,472 (GRCm39)	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46,940,099 (GRCm39)	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46,956,020 (GRCm39)	missense	probably benign	0.01
R9749:Kif13a	UTSW	13	46,914,227 (GRCm39)	missense	probably damaging	0.96
X0013:Kif13a	UTSW	13	47,082,746 (GRCm39)	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- TCCAGCTGTGACACACTTCC -3'
(R):5'- TGATGACTATCCCACAGGGC -3'

Sequencing Primer
(F):5'- AGCTGTGACACACTTCCTGTTTC -3'
(R):5'- CTATCCCACAGGGCAAGGAG -3'

Posted On

2015-04-02