Incidental Mutation 'R3500:Mecom'
ID273744
Institutional Source Beutler Lab
Gene Symbol Mecom
Ensembl Gene ENSMUSG00000027684
Gene NameMDS1 and EVI1 complex locus
SynonymsEvi1, Jbo, D630039M04Rik, ZNFPR1B1, Evi-1, Prdm3, Mds1, MDS1-EVI1
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location29951296-30548008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 29980912 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 205 (R205H)
Ref Sequence ENSEMBL: ENSMUSP00000134626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108270] [ENSMUST00000108271] [ENSMUST00000166001] [ENSMUST00000172694] [ENSMUST00000172697] [ENSMUST00000172754] [ENSMUST00000173495] [ENSMUST00000173899]
Predicted Effect probably benign
Transcript: ENSMUST00000108270
AA Change: R205H

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103905
Gene: ENSMUSG00000027684
AA Change: R205H

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 188 210 8.22e-2 SMART
ZnF_C2H2 217 244 9.96e0 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 724 746 5.29e-5 SMART
ZnF_C2H2 752 775 1.6e-4 SMART
ZnF_C2H2 781 803 5.9e-3 SMART
low complexity region 877 896 N/A INTRINSIC
low complexity region 1025 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108271
SMART Domains Protein: ENSMUSP00000103906
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
Blast:SET 9 85 3e-44 BLAST
PDB:2JV0|A 25 96 2e-12 PDB
ZnF_C2H2 98 118 1.86e1 SMART
ZnF_C2H2 152 174 4.47e-3 SMART
ZnF_C2H2 180 202 1.6e-4 SMART
ZnF_C2H2 208 231 1.13e-4 SMART
ZnF_C2H2 237 259 1.2e-3 SMART
ZnF_C2H2 477 499 5.29e-5 SMART
ZnF_C2H2 505 528 1.6e-4 SMART
ZnF_C2H2 534 556 5.9e-3 SMART
low complexity region 630 649 N/A INTRINSIC
low complexity region 778 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166001
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128563
Gene: ENSMUSG00000027684
AA Change: R205H

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 188 210 8.22e-2 SMART
ZnF_C2H2 217 244 9.96e0 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 5.29e-5 SMART
ZnF_C2H2 761 784 1.6e-4 SMART
ZnF_C2H2 790 812 5.9e-3 SMART
low complexity region 886 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170212
Predicted Effect probably benign
Transcript: ENSMUST00000172694
SMART Domains Protein: ENSMUSP00000134303
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
ZnF_C2H2 21 41 1.86e1 SMART
ZnF_C2H2 75 97 4.47e-3 SMART
ZnF_C2H2 103 125 1.6e-4 SMART
ZnF_C2H2 131 154 1.13e-4 SMART
ZnF_C2H2 160 182 1.2e-3 SMART
ZnF_C2H2 400 422 5.29e-5 SMART
ZnF_C2H2 428 451 1.6e-4 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
low complexity region 553 572 N/A INTRINSIC
low complexity region 701 716 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172697
AA Change: R395H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134117
Gene: ENSMUSG00000027684
AA Change: R395H

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 923 945 5.29e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172754
Predicted Effect probably benign
Transcript: ENSMUST00000173059
SMART Domains Protein: ENSMUSP00000133310
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
SET 15 133 5.46e-15 SMART
ZnF_C2H2 146 166 1.86e1 SMART
ZnF_C2H2 200 222 4.47e-3 SMART
ZnF_C2H2 228 250 1.6e-4 SMART
ZnF_C2H2 256 279 1.13e-4 SMART
ZnF_C2H2 285 307 1.2e-3 SMART
ZnF_C2H2 525 547 5.29e-5 SMART
ZnF_C2H2 553 576 1.6e-4 SMART
ZnF_C2H2 582 604 5.9e-3 SMART
low complexity region 678 697 N/A INTRINSIC
low complexity region 826 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173495
AA Change: R205H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134626
Gene: ENSMUSG00000027684
AA Change: R205H

DomainStartEndE-ValueType
ZnF_C2H2 21 41 8e-2 SMART
ZnF_C2H2 75 97 1.9e-5 SMART
ZnF_C2H2 103 125 7e-7 SMART
ZnF_C2H2 131 154 4.8e-7 SMART
ZnF_C2H2 160 182 5e-6 SMART
ZnF_C2H2 188 210 3.5e-4 SMART
ZnF_C2H2 217 244 4.3e-2 SMART
low complexity region 297 311 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
ZnF_C2H2 733 755 2.2e-7 SMART
ZnF_C2H2 761 784 7.1e-7 SMART
ZnF_C2H2 790 812 2.5e-5 SMART
low complexity region 886 905 N/A INTRINSIC
low complexity region 1034 1049 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173899
AA Change: R395H

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133410
Gene: ENSMUSG00000027684
AA Change: R395H

DomainStartEndE-ValueType
SET 80 198 5.46e-15 SMART
ZnF_C2H2 211 231 1.86e1 SMART
ZnF_C2H2 265 287 4.47e-3 SMART
ZnF_C2H2 293 315 1.6e-4 SMART
ZnF_C2H2 321 344 1.13e-4 SMART
ZnF_C2H2 350 372 1.2e-3 SMART
ZnF_C2H2 378 400 8.22e-2 SMART
ZnF_C2H2 407 434 9.96e0 SMART
low complexity region 487 501 N/A INTRINSIC
low complexity region 601 613 N/A INTRINSIC
ZnF_C2H2 914 936 5.29e-5 SMART
ZnF_C2H2 942 965 1.6e-4 SMART
ZnF_C2H2 971 993 5.9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174413
SMART Domains Protein: ENSMUSP00000134278
Gene: ENSMUSG00000027684

DomainStartEndE-ValueType
ZnF_C2H2 11 31 1.86e1 SMART
ZnF_C2H2 65 87 4.47e-3 SMART
ZnF_C2H2 93 115 1.6e-4 SMART
ZnF_C2H2 121 144 1.13e-4 SMART
ZnF_C2H2 150 172 1.2e-3 SMART
ZnF_C2H2 390 412 5.29e-5 SMART
ZnF_C2H2 418 441 1.6e-4 SMART
ZnF_C2H2 447 469 5.9e-3 SMART
low complexity region 543 562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174428
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulator and oncoprotein that may be involved in hematopoiesis, apoptosis, development, and cell differentiation and proliferation. The encoded protein can interact with CTBP1, SMAD3, CREBBP, KAT2B, MAPK8, and MAPK9. This gene can undergo translocation with the AML1 gene, resulting in overexpression of this gene and the onset of leukemia. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation die at 10.5 dpc displaying widespread hypocellularity, hemorrhage, and disruption in the development of the heart, somites, and neural crest-derived cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Mecom
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01978:Mecom APN 3 29963166 missense probably damaging 0.99
IGL02800:Mecom APN 3 29961034 missense probably damaging 1.00
IGL03052:Mecom APN 3 29960963 splice site probably benign
IGL03237:Mecom APN 3 29956499 intron probably benign
R0004:Mecom UTSW 3 29979911 missense probably damaging 1.00
R0299:Mecom UTSW 3 29980411 missense probably benign 0.41
R0324:Mecom UTSW 3 29963112 missense probably damaging 0.99
R0485:Mecom UTSW 3 29980972 intron probably benign
R0696:Mecom UTSW 3 29956389 missense probably benign 0.01
R1322:Mecom UTSW 3 29957373 missense probably damaging 0.98
R1396:Mecom UTSW 3 29979800 missense possibly damaging 0.50
R1419:Mecom UTSW 3 29980889 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1469:Mecom UTSW 3 29980048 missense probably damaging 1.00
R1487:Mecom UTSW 3 29980064 missense probably damaging 1.00
R1620:Mecom UTSW 3 29987088 missense probably damaging 1.00
R1867:Mecom UTSW 3 30509428 critical splice donor site probably null
R1876:Mecom UTSW 3 29993658 missense probably damaging 1.00
R1922:Mecom UTSW 3 29957442 missense probably damaging 0.99
R2044:Mecom UTSW 3 29980592 missense probably damaging 1.00
R2087:Mecom UTSW 3 29952814 missense probably benign 0.01
R2116:Mecom UTSW 3 29965458 missense probably damaging 1.00
R4348:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4350:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4351:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4352:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4353:Mecom UTSW 3 29966738 missense possibly damaging 0.72
R4358:Mecom UTSW 3 29979785 nonsense probably null
R4370:Mecom UTSW 3 29957355 missense probably damaging 1.00
R4380:Mecom UTSW 3 29987070 missense probably damaging 1.00
R4676:Mecom UTSW 3 30268668 intron probably benign
R4690:Mecom UTSW 3 30238310 missense probably benign 0.01
R4750:Mecom UTSW 3 29957530 missense probably damaging 0.97
R4812:Mecom UTSW 3 30140368 start codon destroyed probably null
R4821:Mecom UTSW 3 29985351 missense probably damaging 1.00
R4986:Mecom UTSW 3 29980699 missense probably damaging 0.99
R5020:Mecom UTSW 3 29961106 missense probably damaging 1.00
R5099:Mecom UTSW 3 29985316 intron probably benign
R5410:Mecom UTSW 3 29997721 missense probably benign 0.01
R5415:Mecom UTSW 3 29957526 missense possibly damaging 0.93
R5556:Mecom UTSW 3 30238100 missense probably damaging 1.00
R5811:Mecom UTSW 3 29961000 missense probably benign 0.00
R5955:Mecom UTSW 3 29961046 missense probably damaging 1.00
R6153:Mecom UTSW 3 29993648 missense possibly damaging 0.92
R6321:Mecom UTSW 3 29980592 missense probably damaging 1.00
R6335:Mecom UTSW 3 29980756 missense probably damaging 1.00
R6383:Mecom UTSW 3 29997726 missense probably damaging 1.00
R6435:Mecom UTSW 3 29980249 missense probably damaging 1.00
R6468:Mecom UTSW 3 30140386 intron probably benign
R6476:Mecom UTSW 3 29980568 missense possibly damaging 0.70
R6673:Mecom UTSW 3 29980702 missense probably benign 0.09
R6721:Mecom UTSW 3 29979874 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGCCAAAATAGTCAGCCAG -3'
(R):5'- GATCGCTGACTCCCAACTTC -3'

Sequencing Primer
(F):5'- CGGGTTGGCATGACTCATATTAACC -3'
(R):5'- CTATTCCTGGCTTCCTAATTGAAAC -3'
Posted On2015-04-02