Incidental Mutation 'R3500:Ppp3ca'
ID273749
Institutional Source Beutler Lab
Gene Symbol Ppp3ca
Ensembl Gene ENSMUSG00000028161
Gene Nameprotein phosphatase 3, catalytic subunit, alpha isoform
SynonymsCaln, PP2BA alpha, 2900074D19Rik, PP2B alpha 1, Calna, CnA, CN
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location136670124-136937727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136881512 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 252 (T252A)
Ref Sequence ENSEMBL: ENSMUSP00000071040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056758] [ENSMUST00000070198]
Predicted Effect probably benign
Transcript: ENSMUST00000056758
AA Change: T252A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053101
Gene: ENSMUSG00000028161
AA Change: T252A

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 507 519 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070198
AA Change: T252A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000071040
Gene: ENSMUSG00000028161
AA Change: T252A

DomainStartEndE-ValueType
PP2Ac 56 347 2.91e-162 SMART
low complexity region 497 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196170
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation and abnormal mossy fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Ppp3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Ppp3ca APN 3 136935181 missense probably benign 0.01
IGL01405:Ppp3ca APN 3 136868721 missense probably benign 0.33
IGL02061:Ppp3ca APN 3 136797863 missense probably benign
IGL02285:Ppp3ca APN 3 136928626 splice site probably benign
IGL02472:Ppp3ca APN 3 136921862 missense possibly damaging 0.57
IGL02706:Ppp3ca APN 3 136905318 missense possibly damaging 0.84
IGL02894:Ppp3ca APN 3 136797812 missense probably damaging 1.00
R0325:Ppp3ca UTSW 3 136935139 missense probably benign 0.15
R1072:Ppp3ca UTSW 3 136935127 missense probably benign
R1427:Ppp3ca UTSW 3 136921914 missense probably damaging 1.00
R1524:Ppp3ca UTSW 3 136797818 missense probably benign
R1568:Ppp3ca UTSW 3 136928544 missense probably benign 0.00
R1754:Ppp3ca UTSW 3 136881448 missense probably benign 0.20
R1800:Ppp3ca UTSW 3 136935031 missense probably damaging 0.98
R1844:Ppp3ca UTSW 3 136921911 missense probably benign 0.08
R1878:Ppp3ca UTSW 3 136797878 missense probably benign 0.03
R2155:Ppp3ca UTSW 3 136890450 missense possibly damaging 0.95
R2160:Ppp3ca UTSW 3 136877630 missense probably damaging 1.00
R2220:Ppp3ca UTSW 3 136797924 missense probably damaging 1.00
R2331:Ppp3ca UTSW 3 136797819 missense probably benign
R3052:Ppp3ca UTSW 3 136797844 missense probably benign 0.00
R4764:Ppp3ca UTSW 3 136890489 missense probably damaging 0.99
R4974:Ppp3ca UTSW 3 136935049 missense possibly damaging 0.60
R5952:Ppp3ca UTSW 3 136928571 missense probably benign 0.08
R6051:Ppp3ca UTSW 3 136876122 missense probably damaging 1.00
R6395:Ppp3ca UTSW 3 136877770 missense possibly damaging 0.47
R6975:Ppp3ca UTSW 3 136905301 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCACTCAGAGCTTCTGTG -3'
(R):5'- TTAACGAACTGCAGCCATCC -3'

Sequencing Primer
(F):5'- GTGTTCTGATTTCTAAGTGTCCAAAG -3'
(R):5'- CCAAGATCCAGCTCTTTCAATC -3'
Posted On2015-04-02