Incidental Mutation 'R3500:0610037L13Rik'
List |< first << previous [record 52 of 386652] next >> last >|
ID273751
Institutional Source Beutler Lab
Gene Symbol 0610037L13Rik
Ensembl Gene ENSMUSG00000028608
Gene NameRIKEN cDNA 0610037L13 gene
Synonyms
MMRRC Submission 040663-MU
Accession Numbers
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location107889813-107899384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 107891513 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 47 (R47W)
Ref Sequence ENSEMBL: ENSMUSP00000119565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030347] [ENSMUST00000106726] [ENSMUST00000106727] [ENSMUST00000119394] [ENSMUST00000120473] [ENSMUST00000125107] [ENSMUST00000128474] [ENSMUST00000132417] [ENSMUST00000135454] [ENSMUST00000153593]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030347
AA Change: R61W
Predicted Effect possibly damaging
Transcript: ENSMUST00000106726
AA Change: R47W

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102337
Gene: ENSMUSG00000028608
AA Change: R47W

DomainStartEndE-ValueType
Pfam:DUF866 1 114 1.9e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106727
AA Change: R47W

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102338
Gene: ENSMUSG00000028608
AA Change: R47W

DomainStartEndE-ValueType
Pfam:DUF866 1 154 1.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119394
AA Change: R47W

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113991
Gene: ENSMUSG00000028608
AA Change: R47W

DomainStartEndE-ValueType
Pfam:DUF866 1 146 8.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120473
AA Change: R47W

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113866
Gene: ENSMUSG00000028608
AA Change: R47W

DomainStartEndE-ValueType
Pfam:DUF866 1 138 2.7e-62 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000119565
Gene: ENSMUSG00000028608
AA Change: R83W

DomainStartEndE-ValueType
Pfam:DUF866 40 194 2.2e-61 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128474
AA Change: R48W

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115797
Gene: ENSMUSG00000028608
AA Change: R48W

DomainStartEndE-ValueType
Pfam:DUF866 2 66 4.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132417
AA Change: R83W

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117717
Gene: ENSMUSG00000028608
AA Change: R83W

DomainStartEndE-ValueType
Pfam:DUF866 37 98 1.4e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135454
AA Change: R47W

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114234
Gene: ENSMUSG00000028608
AA Change: R47W

DomainStartEndE-ValueType
Pfam:DUF866 1 160 1.7e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153593
AA Change: P120L
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E122K probably damaging Het
Atp10d C T 5: 72,245,723 R319C not run Het
BC003331 G A 1: 150,383,076 R230* probably null Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H1850N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably null Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C918S probably benign Het
Cnot4 G A 6: 35,080,141 unknown Het
Copg1 G A 6: 87,895,923 probably benign Het
Cox15 T A 19: 43,739,918 Q62L noncoding transcript Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Homo
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 unknown Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm10848 A G 2: 14,707,578 I356T noncoding transcript Het
Gm9396 C A 3: 130,068,495 F28L possibly damaging Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Ktn1 T G 14: 47,704,390 V139G noncoding transcript Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R395H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Mroh2a CTCTCTCTCTCTCTCTCTCTCTCTCTC CTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC 1: 88,247,714 Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A969T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Pla2r1 G A 2: 60,530,395 R276* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V possibly damaging Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Uvssa T C 5: 33,387,875 S333P noncoding transcript Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in 0610037L13Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:0610037L13Rik APN 4 107894868 unclassified 0.00
R0787:0610037L13Rik UTSW 4 107890129 missense probably damaging 1.00
R4702:0610037L13Rik UTSW 4 107893316 missense noncoding transcript
R4778:0610037L13Rik UTSW 4 107891998 missense probably damaging 1.00
R5940:0610037L13Rik UTSW 4 107893288 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATCGGCTCATGTCCCTATTG -3'
(R):5'- AAGTCCCTCTTGATTTTGAACTCTG -3'

Sequencing Primer
(F):5'- CACATTTGGGCTACACAGTG -3'
(R):5'- CACATTGGTGCTCTCTCAA -3'
Posted OnApr 02, 2015