Incidental Mutation 'R3500:Clcn1'
ID 273756
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Name chloride channel, voltage-sensitive 1
Synonyms Clc1, SMCC1, NMF355, Clc-1, nmf355
MMRRC Submission 040663-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3500 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 42263619-42292690 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42269929 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031894] [ENSMUST00000164091] [ENSMUST00000168660]
AlphaFold Q64347
Predicted Effect probably damaging
Transcript: ENSMUST00000031894
AA Change: S251P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: S251P

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: S221P
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
AA Change: S251P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862
AA Change: S251P

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000165780
AA Change: S221P
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168660
AA Change: S218P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862
AA Change: S218P

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000169024
AA Change: S221P
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000170028
AA Change: S221P
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862
AA Change: S221P

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.2611 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amhr2 A G 15: 102,355,501 (GRCm39) D188G probably benign Het
Arl15 G A 13: 114,104,228 (GRCm39) E102K probably damaging Het
Atp10d C T 5: 72,403,066 (GRCm39) R319C probably damaging Het
Cetn4 A T 3: 37,364,109 (GRCm39) F34I probably benign Het
Chd8 G T 14: 52,443,110 (GRCm39) H510N probably benign Het
Chil5 T C 3: 105,925,536 (GRCm39) D157G probably damaging Het
Clstn3 A T 6: 124,408,670 (GRCm39) C881S probably benign Het
Cnot4 G A 6: 35,057,076 (GRCm39) probably benign Het
Copg1 G A 6: 87,872,905 (GRCm39) probably benign Het
Czib C T 4: 107,748,710 (GRCm39) R83W probably damaging Het
Eftud2 A G 11: 102,735,006 (GRCm39) M631T probably damaging Het
Elavl3 A G 9: 21,930,040 (GRCm39) V288A probably damaging Het
Fancb A G X: 163,779,104 (GRCm39) T721A probably damaging Het
Fat2 A G 11: 55,151,342 (GRCm39) F3800S probably damaging Het
Fgd2 T C 17: 29,584,575 (GRCm39) V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 (GRCm39) probably benign Het
Gata4 C T 14: 63,437,982 (GRCm39) G390S possibly damaging Het
Gm9396 C A 3: 129,862,144 (GRCm39) noncoding transcript Het
Grid2 T C 6: 63,480,383 (GRCm39) S66P probably damaging Het
Hdac9 C A 12: 34,487,352 (GRCm39) M16I probably benign Het
Kmt2c A T 5: 25,504,477 (GRCm39) D3610E probably benign Het
Lactb2 A T 1: 13,730,673 (GRCm39) M1K probably null Het
Ldhb T C 6: 142,447,173 (GRCm39) D47G probably damaging Het
Map3k11 A T 19: 5,740,275 (GRCm39) M1L probably benign Het
Mecom C T 3: 30,035,061 (GRCm39) R205H probably damaging Het
Mob1b A G 5: 88,897,479 (GRCm39) D129G probably benign Het
Nbea A G 3: 55,588,431 (GRCm39) V2436A possibly damaging Het
Neb T C 2: 52,215,797 (GRCm39) N170S probably damaging Het
Nedd4l G A 18: 65,345,931 (GRCm39) A848T probably damaging Het
Nr5a1 G A 2: 38,597,952 (GRCm39) R282* probably null Het
Or4c102 A G 2: 88,422,285 (GRCm39) T46A probably damaging Het
Or4c119 C T 2: 88,987,403 (GRCm39) G39R probably damaging Het
Or4d10c A G 19: 12,065,421 (GRCm39) V245A possibly damaging Het
Or4f47 T C 2: 111,972,472 (GRCm39) F61L possibly damaging Het
Or52e2 T C 7: 102,804,297 (GRCm39) Y219C probably damaging Het
Pcdhb19 T A 18: 37,630,532 (GRCm39) L109* probably null Het
Plcg2 A G 8: 118,339,717 (GRCm39) M1043V probably benign Het
Podxl2 T C 6: 88,819,900 (GRCm39) D554G probably damaging Het
Ppp3ca A G 3: 136,587,273 (GRCm39) T252A probably benign Het
Pramel6 A G 2: 87,339,569 (GRCm39) H111R probably damaging Het
Prr19 A G 7: 25,002,692 (GRCm39) E130G probably damaging Het
Rab44 C T 17: 29,357,041 (GRCm39) A57V probably benign Het
Rhbdl3 T C 11: 80,210,531 (GRCm39) F95L probably damaging Het
Sdk1 G T 5: 141,992,371 (GRCm39) probably benign Het
Tas2r122 T A 6: 132,688,523 (GRCm39) K123N probably damaging Het
Tbpl2 C T 2: 23,977,151 (GRCm39) R289Q probably benign Het
Trpm2 A G 10: 77,768,136 (GRCm39) F788L probably benign Het
Ttn G A 2: 76,560,628 (GRCm39) L29258F probably damaging Het
Ttn G T 2: 76,591,509 (GRCm39) F19307L possibly damaging Het
Vmn2r23 T C 6: 123,690,129 (GRCm39) I335T possibly damaging Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42,268,637 (GRCm39) missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42,287,606 (GRCm39) splice site probably benign
IGL02055:Clcn1 APN 6 42,284,489 (GRCm39) missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42,284,007 (GRCm39) splice site probably benign
IGL02649:Clcn1 APN 6 42,275,763 (GRCm39) missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42,263,714 (GRCm39) splice site probably null
IGL03148:Clcn1 APN 6 42,276,925 (GRCm39) critical splice donor site probably null
IGL03190:Clcn1 APN 6 42,267,037 (GRCm39) missense probably benign 0.02
IGL03327:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
IGL03346:Clcn1 APN 6 42,288,153 (GRCm39) missense probably benign 0.00
Faint UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
jack_spratt UTSW 6 42,287,515 (GRCm39) missense probably benign
Limitations UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
maimed UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
stunted UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R0167:Clcn1 UTSW 6 42,263,770 (GRCm39) missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42,287,074 (GRCm39) missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42,287,515 (GRCm39) missense probably benign
R0573:Clcn1 UTSW 6 42,289,979 (GRCm39) splice site probably null
R0615:Clcn1 UTSW 6 42,282,509 (GRCm39) missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42,290,075 (GRCm39) missense probably benign 0.00
R1562:Clcn1 UTSW 6 42,277,169 (GRCm39) missense probably benign 0.29
R1566:Clcn1 UTSW 6 42,268,374 (GRCm39) missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42,290,032 (GRCm39) missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42,271,079 (GRCm39) missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42,276,448 (GRCm39) missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42,275,860 (GRCm39) critical splice donor site probably null
R1861:Clcn1 UTSW 6 42,290,925 (GRCm39) missense possibly damaging 0.63
R1864:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42,282,475 (GRCm39) missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42,268,559 (GRCm39) missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42,290,046 (GRCm39) missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42,275,784 (GRCm39) missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42,267,112 (GRCm39) missense probably damaging 0.98
R3747:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42,276,849 (GRCm39) missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42,286,902 (GRCm39) missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42,267,131 (GRCm39) splice site probably null
R4836:Clcn1 UTSW 6 42,286,898 (GRCm39) missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42,287,922 (GRCm39) nonsense probably null
R5085:Clcn1 UTSW 6 42,290,814 (GRCm39) missense probably benign 0.41
R5528:Clcn1 UTSW 6 42,277,275 (GRCm39) missense probably benign 0.01
R5628:Clcn1 UTSW 6 42,275,823 (GRCm39) missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42,284,199 (GRCm39) missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42,269,900 (GRCm39) missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42,277,208 (GRCm39) nonsense probably null
R6175:Clcn1 UTSW 6 42,291,096 (GRCm39) missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42,290,172 (GRCm39) missense possibly damaging 0.82
R6394:Clcn1 UTSW 6 42,284,524 (GRCm39) missense possibly damaging 0.84
R7012:Clcn1 UTSW 6 42,267,542 (GRCm39) missense probably benign 0.01
R7020:Clcn1 UTSW 6 42,275,754 (GRCm39) missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42,284,477 (GRCm39) missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42,268,323 (GRCm39) missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42,270,396 (GRCm39) missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42,275,772 (GRCm39) missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42,268,268 (GRCm39) nonsense probably null
R7663:Clcn1 UTSW 6 42,286,997 (GRCm39) missense possibly damaging 0.79
R7807:Clcn1 UTSW 6 42,287,282 (GRCm39) splice site probably null
R7954:Clcn1 UTSW 6 42,263,625 (GRCm39) unclassified probably benign
R8026:Clcn1 UTSW 6 42,284,595 (GRCm39) critical splice donor site probably null
R8045:Clcn1 UTSW 6 42,267,628 (GRCm39) missense probably damaging 1.00
R8499:Clcn1 UTSW 6 42,284,133 (GRCm39) missense probably damaging 1.00
R8523:Clcn1 UTSW 6 42,284,523 (GRCm39) nonsense probably null
R8677:Clcn1 UTSW 6 42,267,519 (GRCm39) critical splice acceptor site probably null
R8818:Clcn1 UTSW 6 42,282,477 (GRCm39) missense probably damaging 0.98
R8945:Clcn1 UTSW 6 42,263,701 (GRCm39) start codon destroyed possibly damaging 0.79
R9012:Clcn1 UTSW 6 42,268,567 (GRCm39) missense possibly damaging 0.75
R9295:Clcn1 UTSW 6 42,290,883 (GRCm39) missense probably benign 0.00
R9433:Clcn1 UTSW 6 42,282,494 (GRCm39) missense probably damaging 1.00
R9513:Clcn1 UTSW 6 42,282,462 (GRCm39) missense probably damaging 1.00
R9679:Clcn1 UTSW 6 42,263,753 (GRCm39) missense probably damaging 0.98
Z1088:Clcn1 UTSW 6 42,284,190 (GRCm39) missense probably damaging 1.00
Z1088:Clcn1 UTSW 6 42,277,294 (GRCm39) missense probably benign 0.40
Z1176:Clcn1 UTSW 6 42,284,501 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGGCTGTGGCATTGTC -3'
(R):5'- TATGGCTAGGATCAGCAGGC -3'

Sequencing Primer
(F):5'- CCTCGAATGAGACTCCTTTAAGG -3'
(R):5'- CTAGGATCAGCAGGCAGGGC -3'
Posted On 2015-04-02