Incidental Mutation 'R3500:Grid2'
ID273757
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Nameglutamate receptor, ionotropic, delta 2
SynonymsGluRdelta2, tpr, B230104L07Rik
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location63255876-64704323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63503399 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 66 (S66P)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
Predicted Effect probably damaging
Transcript: ENSMUST00000095852
AA Change: S66P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: S66P

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159561
SMART Domains Protein: ENSMUSP00000125402
Gene: ENSMUSG00000071424

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 2.7e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161105
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64345589 missense probably damaging 1.00
IGL00596:Grid2 APN 6 64533704 missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64320196 missense probably benign 0.00
IGL01712:Grid2 APN 6 64665915 missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64063935 missense probably benign 0.29
IGL02216:Grid2 APN 6 64345666 missense probably damaging 0.96
IGL02563:Grid2 APN 6 64345873 missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64345816 missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64063904 missense probably damaging 0.98
IGL03324:Grid2 APN 6 64429822 missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63909069 missense possibly damaging 0.94
crawler UTSW 6 64429694 nonsense probably null
swagger UTSW 6 64395280 synonymous probably benign
R0133:Grid2 UTSW 6 64320132 missense probably damaging 1.00
R0147:Grid2 UTSW 6 64533587 missense probably benign
R0193:Grid2 UTSW 6 64063953 missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64345734 missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64666052 missense probably benign 0.33
R0600:Grid2 UTSW 6 63503435 missense probably benign 0.38
R0717:Grid2 UTSW 6 64666275 missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64429754 missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64429684 missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64429694 nonsense probably null
R1762:Grid2 UTSW 6 64533654 missense probably damaging 0.98
R1944:Grid2 UTSW 6 63909061 missense probably damaging 1.00
R1961:Grid2 UTSW 6 63908893 missense probably damaging 1.00
R1969:Grid2 UTSW 6 63908918 nonsense probably null
R2138:Grid2 UTSW 6 64345798 missense probably damaging 0.99
R3547:Grid2 UTSW 6 64320021 missense probably damaging 0.97
R3845:Grid2 UTSW 6 64345842 missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63503433 missense probably benign 0.41
R4273:Grid2 UTSW 6 63909045 missense probably damaging 1.00
R4591:Grid2 UTSW 6 64320102 missense probably damaging 1.00
R4701:Grid2 UTSW 6 64665915 missense probably benign 0.27
R4721:Grid2 UTSW 6 64666201 missense probably benign 0.33
R4755:Grid2 UTSW 6 63908988 missense probably benign 0.04
R4869:Grid2 UTSW 6 64429740 missense probably damaging 1.00
R5083:Grid2 UTSW 6 64320152 nonsense probably null
R5091:Grid2 UTSW 6 64076878 missense probably benign 0.07
R5117:Grid2 UTSW 6 63256933 missense probably benign 0.15
R5128:Grid2 UTSW 6 64665998 missense probably benign 0.01
R5386:Grid2 UTSW 6 63931105 missense probably damaging 0.99
R5404:Grid2 UTSW 6 63930910 missense probably damaging 0.99
R5534:Grid2 UTSW 6 63503361 missense probably benign
R5626:Grid2 UTSW 6 64076945 critical splice donor site probably null
R5699:Grid2 UTSW 6 63908991 missense probably damaging 0.99
R5700:Grid2 UTSW 6 64094432 missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64663162 missense probably damaging 1.00
R6446:Grid2 UTSW 6 64345593 missense probably damaging 1.00
R6694:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63931047 missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63931015 missense probably benign 0.01
R6895:Grid2 UTSW 6 64395299 missense probably damaging 0.99
R6999:Grid2 UTSW 6 64076909 missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64700418 missense unknown
R7126:Grid2 UTSW 6 64076810 missense probably damaging 0.99
R7432:Grid2 UTSW 6 64275870 missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64076941 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCATATTGCCAGAGTTCGTG -3'
(R):5'- TCATATGACAGGCCTTCAAAACTTG -3'

Sequencing Primer
(F):5'- GCATATTGCCAGAGTTCGTGATAATG -3'
(R):5'- TACAAGGTAAGAACTCTCAGGAAAAG -3'
Posted On2015-04-02