Incidental Mutation 'R3500:Copg1'
ID273758
Institutional Source Beutler Lab
Gene Symbol Copg1
Ensembl Gene ENSMUSG00000030058
Gene Namecoatomer protein complex, subunit gamma 1
SynonymsD6Ertd71e, Copg, D6Wsu16e
MMRRC Submission 040663-MU
Accession Numbers

Genbank: NM_017477, NM_201244; MGI: 1858696

Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87887814-87913595 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 87895923 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113607]
Predicted Effect probably benign
Transcript: ENSMUST00000113607
SMART Domains Protein: ENSMUSP00000109237
Gene: ENSMUSG00000030058

DomainStartEndE-ValueType
Pfam:Adaptin_N 23 539 4.1e-135 PFAM
Pfam:COP-gamma_platf 611 759 7.6e-64 PFAM
Pfam:Coatomer_g_Cpla 761 873 1.5e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203240
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205234
Meta Mutation Damage Score 0.0932 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
Allele List at MGI

All alleles(58) : Targeted, other(2) Gene trapped(56)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Copg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Copg1 APN 6 87902370 missense possibly damaging 0.94
IGL00816:Copg1 APN 6 87893898 missense possibly damaging 0.95
IGL02087:Copg1 APN 6 87902210 missense possibly damaging 0.68
R0194:Copg1 UTSW 6 87904197 splice site probably benign
R0448:Copg1 UTSW 6 87904926 missense probably benign
R0576:Copg1 UTSW 6 87897963 missense probably damaging 1.00
R0701:Copg1 UTSW 6 87894107 nonsense probably null
R1251:Copg1 UTSW 6 87890007 nonsense probably null
R1707:Copg1 UTSW 6 87905210 missense probably benign
R1845:Copg1 UTSW 6 87893818 missense probably damaging 1.00
R3952:Copg1 UTSW 6 87905216 missense probably benign
R4283:Copg1 UTSW 6 87908545 missense probably damaging 1.00
R4515:Copg1 UTSW 6 87907546 intron probably benign
R4715:Copg1 UTSW 6 87912286 nonsense probably null
R4797:Copg1 UTSW 6 87903468 intron probably benign
R4864:Copg1 UTSW 6 87889696 missense probably damaging 1.00
R4947:Copg1 UTSW 6 87903473 splice site probably benign
R5265:Copg1 UTSW 6 87892270 missense probably damaging 0.98
R5288:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5386:Copg1 UTSW 6 87890207 missense possibly damaging 0.90
R5511:Copg1 UTSW 6 87912294 missense probably damaging 0.99
R5670:Copg1 UTSW 6 87912235 missense probably damaging 1.00
R5887:Copg1 UTSW 6 87902297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTGTAGCTCACCCAAGGC -3'
(R):5'- TCTGAGATCTCCGACATGAAGG -3'

Sequencing Primer
(F):5'- AAGGCTGCACTTCGCTATG -3'
(R):5'- GAGGAAATCTGCTTCATAAGGC -3'
Posted On2015-04-02