Incidental Mutation 'R3500:Podxl2'
ID273759
Institutional Source Beutler Lab
Gene Symbol Podxl2
Ensembl Gene ENSMUSG00000033152
Gene Namepodocalyxin-like 2
SynonymsPODLX2, D130074J02Rik
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3500 (G1)
Quality Score205
Status Validated
Chromosome6
Chromosomal Location88842558-88875044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88842918 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 554 (D554G)
Ref Sequence ENSEMBL: ENSMUSP00000117954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032169] [ENSMUST00000038409] [ENSMUST00000061262] [ENSMUST00000145944] [ENSMUST00000203137] [ENSMUST00000203272] [ENSMUST00000203864] [ENSMUST00000204327] [ENSMUST00000204458] [ENSMUST00000204932] [ENSMUST00000205082]
Predicted Effect probably benign
Transcript: ENSMUST00000032169
SMART Domains Protein: ENSMUSP00000032169
Gene: ENSMUSG00000030083

DomainStartEndE-ValueType
ANK 1 31 5.03e2 SMART
ANK 35 64 2.81e-4 SMART
BTB 115 212 7.8e-18 SMART
BTB 272 376 4.24e-19 SMART
low complexity region 412 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038409
AA Change: D490G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040417
Gene: ENSMUSG00000033152
AA Change: D490G

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 9e-77 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061262
AA Change: D490G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058985
Gene: ENSMUSG00000033152
AA Change: D490G

DomainStartEndE-ValueType
coiled coil region 88 125 N/A INTRINSIC
low complexity region 132 152 N/A INTRINSIC
Pfam:CD34_antigen 328 539 5.4e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141348
SMART Domains Protein: ENSMUSP00000121139
Gene: ENSMUSG00000033152

DomainStartEndE-ValueType
Pfam:CD34_antigen 77 176 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141401
Predicted Effect probably damaging
Transcript: ENSMUST00000145944
AA Change: D554G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117954
Gene: ENSMUSG00000033152
AA Change: D554G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
coiled coil region 152 189 N/A INTRINSIC
low complexity region 196 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147542
Predicted Effect probably benign
Transcript: ENSMUST00000203120
Predicted Effect probably benign
Transcript: ENSMUST00000203137
Predicted Effect probably benign
Transcript: ENSMUST00000203272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203514
Predicted Effect probably benign
Transcript: ENSMUST00000203864
Predicted Effect probably benign
Transcript: ENSMUST00000204327
Predicted Effect probably benign
Transcript: ENSMUST00000204458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204560
Predicted Effect probably benign
Transcript: ENSMUST00000204932
Predicted Effect probably benign
Transcript: ENSMUST00000205082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205158
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the CD34 family of cell surface transmembrane proteins, which are characterized by an N-terminal extracellular mucin domain, globular and stalk domains, a single pass transmembrane region, and a charged cytoplasmic tail. The encoded protein is a ligand for vascular selectins. [provided by RefSeq, Oct 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Amhr2 A G 15: 102,447,066 D188G probably benign Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Podxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01541:Podxl2 APN 6 88849349 missense probably benign 0.00
IGL01642:Podxl2 APN 6 88843547 missense probably damaging 1.00
R0295:Podxl2 UTSW 6 88849678 missense probably benign 0.06
R0336:Podxl2 UTSW 6 88849595 missense probably benign 0.12
R0625:Podxl2 UTSW 6 88849955 missense possibly damaging 0.74
R1239:Podxl2 UTSW 6 88849983 missense probably benign 0.35
R1316:Podxl2 UTSW 6 88849217 missense probably benign 0.05
R1650:Podxl2 UTSW 6 88849919 missense probably benign 0.06
R1933:Podxl2 UTSW 6 88849605 missense probably benign 0.05
R2338:Podxl2 UTSW 6 88849196 missense probably damaging 1.00
R5243:Podxl2 UTSW 6 88849374 missense probably benign 0.00
R5726:Podxl2 UTSW 6 88848739 missense probably damaging 1.00
R5763:Podxl2 UTSW 6 88849823 missense probably damaging 1.00
R6247:Podxl2 UTSW 6 88849317 nonsense probably null
R6527:Podxl2 UTSW 6 88842930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAATGGAGTCCTGGCGC -3'
(R):5'- TAGGTTTGAGTTGCAGGCAC -3'

Sequencing Primer
(F):5'- AAGCATAGTGGTCCGCGTG -3'
(R):5'- AGTTGCAGGCACTTGTATCC -3'
Posted On2015-04-02