Incidental Mutation 'R3500:Amhr2'
ID273779
Institutional Source Beutler Lab
Gene Symbol Amhr2
Ensembl Gene ENSMUSG00000023047
Gene Nameanti-Mullerian hormone type 2 receptor
SynonymsMIS TypeII receptor, MISIIR
MMRRC Submission 040663-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.750) question?
Stock #R3500 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102445367-102454633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102447066 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000154968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023809] [ENSMUST00000229278] [ENSMUST00000229566]
Predicted Effect probably benign
Transcript: ENSMUST00000023809
AA Change: D188G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023809
Gene: ENSMUSG00000023047
AA Change: D188G

DomainStartEndE-ValueType
Pfam:Activin_recp 46 124 3.4e-7 PFAM
transmembrane domain 146 168 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Pfam:Pkinase 199 501 4.6e-25 PFAM
Pfam:Pkinase_Tyr 199 501 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229278
AA Change: D188G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000229566
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract, but also a uterus and oviducts. Functional sperm are produced, but most males are infertile because female reproductive organs block sperm transfer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik C T 4: 107,891,513 R83W probably damaging Het
Arl15 G A 13: 113,967,692 E102K probably damaging Het
Atp10d C T 5: 72,245,723 R319C probably damaging Het
Cetn4 A T 3: 37,309,960 F34I probably benign Het
Chd8 G T 14: 52,205,653 H510N probably benign Het
Chil5 T C 3: 106,018,220 D157G probably damaging Het
Clcn1 T C 6: 42,292,995 S251P probably damaging Het
Clstn3 A T 6: 124,431,711 C881S probably benign Het
Cnot4 G A 6: 35,080,141 probably benign Het
Copg1 G A 6: 87,895,923 probably benign Het
Eftud2 A G 11: 102,844,180 M631T probably damaging Het
Elavl3 A G 9: 22,018,744 V288A probably damaging Het
Fancb A G X: 164,996,108 T721A probably damaging Het
Fat2 A G 11: 55,260,516 F3800S probably damaging Het
Fgd2 T C 17: 29,365,601 V173A possibly damaging Het
Gabrr1 T C 4: 33,158,184 probably benign Het
Gata4 C T 14: 63,200,533 G390S possibly damaging Het
Gm9396 C A 3: 130,068,495 noncoding transcript Het
Grid2 T C 6: 63,503,399 S66P probably damaging Het
Hdac9 C A 12: 34,437,353 M16I probably benign Het
Kmt2c A T 5: 25,299,479 D3610E probably benign Het
Lactb2 A T 1: 13,660,449 M1K probably null Het
Ldhb T C 6: 142,501,447 D47G probably damaging Het
Map3k11 A T 19: 5,690,247 M1L probably benign Het
Mecom C T 3: 29,980,912 R205H probably damaging Het
Mob1b A G 5: 88,749,620 D129G probably benign Het
Nbea A G 3: 55,681,010 V2436A possibly damaging Het
Neb T C 2: 52,325,785 N170S probably damaging Het
Nedd4l G A 18: 65,212,860 A848T probably damaging Het
Nr5a1 G A 2: 38,707,940 R282* probably null Het
Olfr1189 A G 2: 88,591,941 T46A probably damaging Het
Olfr1224-ps1 C T 2: 89,157,059 G39R probably damaging Het
Olfr1317 T C 2: 112,142,127 F61L possibly damaging Het
Olfr1426 A G 19: 12,088,057 V245A possibly damaging Het
Olfr589 T C 7: 103,155,090 Y219C probably damaging Het
Pcdhb19 T A 18: 37,497,479 L109* probably null Het
Plcg2 A G 8: 117,612,978 M1043V probably benign Het
Podxl2 T C 6: 88,842,918 D554G probably damaging Het
Ppp3ca A G 3: 136,881,512 T252A probably benign Het
Pramel6 A G 2: 87,509,225 H111R probably damaging Het
Prr19 A G 7: 25,303,267 E130G probably damaging Het
Rab44 C T 17: 29,138,067 A57V probably benign Het
Rhbdl3 T C 11: 80,319,705 F95L probably damaging Het
Sdk1 G T 5: 142,006,616 probably benign Het
Tas2r122 T A 6: 132,711,560 K123N probably damaging Het
Tbpl2 C T 2: 24,087,139 R289Q probably benign Het
Trpm2 A G 10: 77,932,302 F788L probably benign Het
Ttn G A 2: 76,730,284 L29258F probably damaging Het
Ttn G T 2: 76,761,165 F19307L possibly damaging Het
Vmn2r23 T C 6: 123,713,170 I335T possibly damaging Het
Other mutations in Amhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02273:Amhr2 APN 15 102452489 missense probably benign 0.02
IGL02941:Amhr2 APN 15 102447289 missense probably damaging 1.00
R0269:Amhr2 UTSW 15 102447068 missense probably benign 0.39
R0645:Amhr2 UTSW 15 102446428 missense probably damaging 1.00
R1128:Amhr2 UTSW 15 102452821 missense probably benign 0.10
R1857:Amhr2 UTSW 15 102446777 nonsense probably null
R3882:Amhr2 UTSW 15 102445898 missense probably damaging 1.00
R4661:Amhr2 UTSW 15 102454253 missense probably damaging 1.00
R4980:Amhr2 UTSW 15 102454330 missense probably benign 0.00
R5053:Amhr2 UTSW 15 102447258 missense probably damaging 1.00
X0013:Amhr2 UTSW 15 102452752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGGTTGAAGCCTCCTC -3'
(R):5'- ACCTCCTTCCTGGATTACCTAGTAG -3'

Sequencing Primer
(F):5'- AGGCTCTGCTGATCCCC -3'
(R):5'- CCTTCCTGGATTACCTAGTAGAGAGG -3'
Posted On2015-04-02