Incidental Mutation 'R3827:Adcy5'
ID273820
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission 040775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R3827 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35290097 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 878 (N878S)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably benign
Transcript: ENSMUST00000114913
AA Change: N878S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: N878S

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231960
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Cntnap5a G A 1: 116,117,679 D342N probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dpp10 G A 1: 123,411,790 T336I possibly damaging Het
Ehmt2 T C 17: 34,906,765 S625P possibly damaging Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gab2 T A 7: 97,223,741 I117N probably damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gper1 T C 5: 139,427,000 S367P probably benign Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
H2-Q6 A T 17: 35,425,679 N148I probably damaging Het
Kif21b T C 1: 136,162,994 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr596 T A 7: 103,309,802 I27N probably benign Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Paip1 T A 13: 119,430,232 M1K probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Skint6 G T 4: 112,937,437 L712I probably benign Het
Slc35a4 C A 18: 36,682,988 N290K probably damaging Het
Slco1a5 T A 6: 142,253,249 D230V probably damaging Het
Sox21 C T 14: 118,235,458 E60K possibly damaging Het
Steap3 G A 1: 120,227,730 R500C probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Sulf1 G A 1: 12,817,432 V277I probably benign Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Syne2 A G 12: 75,987,031 R3685G probably benign Het
Tmem203 T A 2: 25,256,006 W113R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Vmn2r102 T A 17: 19,694,525 V784E probably damaging Het
Wrn T C 8: 33,324,520 T56A probably benign Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACAGTGCTGCTCCTGAGAC -3'
(R):5'- CAGCTATGTTGTGAACACCGTC -3'

Sequencing Primer
(F):5'- AGACAGGGTGGGTCTGGTAC -3'
(R):5'- CACCGTCTTTGTAATAAGGAGGC -3'
Posted On2015-04-02