Incidental Mutation 'R3827:Olfr99'
ID273826
Institutional Source Beutler Lab
Gene Symbol Olfr99
Ensembl Gene ENSMUSG00000061972
Gene Nameolfactory receptor 99
SynonymsMOR156-1, GA_x6K02T2PSCP-1720261-1719344
MMRRC Submission 040775-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R3827 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37279043-37283460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37280249 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 57 (Y57F)
Ref Sequence ENSEMBL: ENSMUSP00000148900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077585] [ENSMUST00000216328]
Predicted Effect probably damaging
Transcript: ENSMUST00000077585
AA Change: Y57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076781
Gene: ENSMUSG00000061972
AA Change: Y57F

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.8e-58 PFAM
Pfam:7TM_GPCR_Srsx 32 302 1.4e-6 PFAM
Pfam:7tm_1 38 287 1e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173568
Predicted Effect probably damaging
Transcript: ENSMUST00000216328
AA Change: Y57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216370
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 A G 16: 35,290,097 N878S probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Cntnap5a G A 1: 116,117,679 D342N probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Dpp10 G A 1: 123,411,790 T336I possibly damaging Het
Ehmt2 T C 17: 34,906,765 S625P possibly damaging Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Ffar2 A T 7: 30,820,085 I10N possibly damaging Het
Gab2 T A 7: 97,223,741 I117N probably damaging Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gper1 T C 5: 139,427,000 S367P probably benign Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
H2-Q6 A T 17: 35,425,679 N148I probably damaging Het
Kif21b T C 1: 136,162,994 probably null Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Olfr596 T A 7: 103,309,802 I27N probably benign Het
Paip1 T A 13: 119,430,232 M1K probably null Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rrm2 G T 12: 24,708,599 A47S probably benign Het
Rsph6a T C 7: 19,057,614 L236P probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Sh3bp1 T C 15: 78,904,497 S241P possibly damaging Het
Skint6 G T 4: 112,937,437 L712I probably benign Het
Slc35a4 C A 18: 36,682,988 N290K probably damaging Het
Slco1a5 T A 6: 142,253,249 D230V probably damaging Het
Sox21 C T 14: 118,235,458 E60K possibly damaging Het
Steap3 G A 1: 120,227,730 R500C probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Sulf1 G A 1: 12,817,432 V277I probably benign Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Syne2 A G 12: 75,987,031 R3685G probably benign Het
Tmem203 T A 2: 25,256,006 W113R possibly damaging Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tspan18 T C 2: 93,220,108 I57V probably benign Het
Vmn2r102 T A 17: 19,694,525 V784E probably damaging Het
Wrn T C 8: 33,324,520 T56A probably benign Het
Zfhx4 A T 3: 5,401,209 K2142N probably damaging Het
Other mutations in Olfr99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01878:Olfr99 APN 17 37280000 missense possibly damaging 0.46
IGL02954:Olfr99 APN 17 37280304 missense probably damaging 1.00
R0533:Olfr99 UTSW 17 37280291 nonsense probably null
R1480:Olfr99 UTSW 17 37279745 missense probably benign 0.01
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R2872:Olfr99 UTSW 17 37279976 missense possibly damaging 0.64
R3772:Olfr99 UTSW 17 37279854 missense probably benign 0.00
R3826:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R3829:Olfr99 UTSW 17 37280249 missense probably damaging 1.00
R5210:Olfr99 UTSW 17 37279933 missense probably benign 0.13
R5361:Olfr99 UTSW 17 37279610 missense probably benign 0.02
R6213:Olfr99 UTSW 17 37280373 missense probably benign
R6399:Olfr99 UTSW 17 37279775 missense probably damaging 1.00
R6881:Olfr99 UTSW 17 37280309 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGTAGCGCAGTGGATGAC -3'
(R):5'- TCTTAAAATACAAGACCCGGGATG -3'

Sequencing Primer
(F):5'- CTGTCAATAGCCATGACTGCTAG -3'
(R):5'- ATGAACTGCAGTCAGGCTC -3'
Posted On2015-04-02