Incidental Mutation 'R3829:Ncapg2'
ID273909
Institutional Source Beutler Lab
Gene Symbol Ncapg2
Ensembl Gene ENSMUSG00000042029
Gene Namenon-SMC condensin II complex, subunit G2
SynonymsLuzp5, 5830426I05Rik, mCAP-G2, Mtb
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location116405402-116463731 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 116407318 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084828] [ENSMUST00000221114] [ENSMUST00000221970] [ENSMUST00000222469]
Predicted Effect probably benign
Transcript: ENSMUST00000084828
SMART Domains Protein: ENSMUSP00000081889
Gene: ENSMUSG00000042029

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Pfam:Condensin2nSMC 212 361 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220477
Predicted Effect probably benign
Transcript: ENSMUST00000221114
Predicted Effect probably benign
Transcript: ENSMUST00000221970
Predicted Effect probably benign
Transcript: ENSMUST00000222469
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Condensin2nSMC family of proteins. The encoded protein is a regulatory subunit of the condensin II complex which, along with the condensin I complex, plays a role in chromosome assembly and segregation during mitosis. A similar protein in mouse is required for early development of the embryo. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null embryos exhibit impaired inner cell mass expansion and die shortly after implantation and prior to gastrulation and blood cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Lpcat1 T C 13: 73,489,093 I114T possibly damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Ncapg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Ncapg2 APN 12 116424650 missense possibly damaging 0.54
IGL01694:Ncapg2 APN 12 116407230 utr 5 prime probably benign
IGL01724:Ncapg2 APN 12 116426711 missense probably damaging 1.00
IGL01792:Ncapg2 APN 12 116425818 missense probably damaging 0.99
IGL02098:Ncapg2 APN 12 116444332 missense possibly damaging 0.59
IGL02136:Ncapg2 APN 12 116460583 missense probably benign
IGL02409:Ncapg2 APN 12 116420717 missense probably damaging 1.00
IGL02580:Ncapg2 APN 12 116420689 missense probably damaging 1.00
IGL02653:Ncapg2 APN 12 116425906 critical splice donor site probably null
IGL03073:Ncapg2 APN 12 116452274 missense probably benign 0.01
IGL03114:Ncapg2 APN 12 116452373 splice site probably benign
IGL03199:Ncapg2 APN 12 116419236 missense probably damaging 1.00
IGL03328:Ncapg2 APN 12 116440057 missense possibly damaging 0.90
P0033:Ncapg2 UTSW 12 116438635 missense probably benign 0.03
R0008:Ncapg2 UTSW 12 116429835 missense probably damaging 1.00
R0194:Ncapg2 UTSW 12 116420683 splice site probably null
R0379:Ncapg2 UTSW 12 116443075 missense probably damaging 1.00
R0568:Ncapg2 UTSW 12 116423215 missense probably damaging 1.00
R0771:Ncapg2 UTSW 12 116413159 nonsense probably null
R1016:Ncapg2 UTSW 12 116438675 missense probably damaging 1.00
R1507:Ncapg2 UTSW 12 116460566 missense probably benign 0.00
R1524:Ncapg2 UTSW 12 116434578 splice site probably benign
R1596:Ncapg2 UTSW 12 116419236 missense probably damaging 1.00
R1635:Ncapg2 UTSW 12 116434685 frame shift probably null
R1752:Ncapg2 UTSW 12 116426718 missense probably damaging 1.00
R2164:Ncapg2 UTSW 12 116450475 splice site probably null
R2266:Ncapg2 UTSW 12 116429676 missense probably damaging 1.00
R2366:Ncapg2 UTSW 12 116420729 nonsense probably null
R2924:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R2925:Ncapg2 UTSW 12 116438729 missense probably benign 0.03
R3828:Ncapg2 UTSW 12 116407318 splice site probably benign
R4384:Ncapg2 UTSW 12 116439877 critical splice donor site probably null
R4651:Ncapg2 UTSW 12 116425787 missense probably damaging 1.00
R4701:Ncapg2 UTSW 12 116440618 missense probably benign
R4821:Ncapg2 UTSW 12 116415457 missense probably damaging 0.99
R4845:Ncapg2 UTSW 12 116440588 missense probably damaging 0.96
R5135:Ncapg2 UTSW 12 116427786 missense possibly damaging 0.64
R5294:Ncapg2 UTSW 12 116427794 missense possibly damaging 0.54
R5334:Ncapg2 UTSW 12 116426637 missense probably damaging 1.00
R5588:Ncapg2 UTSW 12 116413077 missense possibly damaging 0.95
R5888:Ncapg2 UTSW 12 116425800 missense possibly damaging 0.84
R5938:Ncapg2 UTSW 12 116429657 missense probably damaging 1.00
R5978:Ncapg2 UTSW 12 116424671 missense possibly damaging 0.68
R6016:Ncapg2 UTSW 12 116426607 missense probably damaging 1.00
R6026:Ncapg2 UTSW 12 116443021 missense possibly damaging 0.73
R6155:Ncapg2 UTSW 12 116438011 missense possibly damaging 0.83
R6509:Ncapg2 UTSW 12 116427756 missense probably damaging 1.00
R6675:Ncapg2 UTSW 12 116434661 missense possibly damaging 0.71
R6912:Ncapg2 UTSW 12 116426582 missense probably benign
R7069:Ncapg2 UTSW 12 116424717 splice site probably null
R7339:Ncapg2 UTSW 12 116414834 missense probably damaging 0.96
X0020:Ncapg2 UTSW 12 116424707 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACGGGACATTTTGCACATTTAC -3'
(R):5'- CTCTTCAGGTTAAAACACAGCC -3'

Sequencing Primer
(F):5'- GACATTTTGCACATTTACGTTTTGG -3'
(R):5'- AGCCTTCTCCTAGTCTTAGGGAG -3'
Posted On2015-04-02