Incidental Mutation 'R3829:Lpcat1'
ID273910
Institutional Source Beutler Lab
Gene Symbol Lpcat1
Ensembl Gene ENSMUSG00000021608
Gene Namelysophosphatidylcholine acyltransferase 1
Synonyms2900035H07Rik, Aytl2, rd11, LPCAT
MMRRC Submission 040776-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R3829 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73467197-73516422 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73489093 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 114 (I114T)
Ref Sequence ENSEMBL: ENSMUSP00000152190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022099] [ENSMUST00000123766] [ENSMUST00000147566] [ENSMUST00000223060]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022099
AA Change: I162T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022099
Gene: ENSMUSG00000021608
AA Change: I162T

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
PlsC 129 239 2.91e-25 SMART
Blast:PlsC 272 314 7e-9 BLAST
EFh 383 411 5.47e-1 SMART
EFh 420 448 4.98e1 SMART
EFh 455 483 4.93e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123766
SMART Domains Protein: ENSMUSP00000117965
Gene: ENSMUSG00000021608

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133791
Predicted Effect probably benign
Transcript: ENSMUST00000147566
Predicted Effect possibly damaging
Transcript: ENSMUST00000223060
AA Change: I114T

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.138 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 1-acyl-sn-glycerol-3-phosphate acyltransferase family of proteins. The encoded enzyme plays a role in phospholipid metabolism, specifically in the conversion of lysophosphatidylcholine to phosphatidylcholine in the presence of acyl-CoA. This process is important in the synthesis of lung surfactant and platelet-activating factor (PAF). Elevated expression of this gene may contribute to the progression of oral squamous cell, prostate, breast, and other human cancers. [provided by RefSeq, Sep 2016]
PHENOTYPE: Some mice homozygous for a gene trapped allele exhibit neonatal lethality associated with respiratory distress, cyanosis, atelectasis, lung hemorrhage, and defective surfactant function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G T 14: 54,584,509 H466Q probably damaging Het
4933411K16Rik A T 19: 42,052,883 H151L probably damaging Het
A330008L17Rik A G 8: 99,421,757 noncoding transcript Het
Abcc5 C A 16: 20,365,865 V1015L probably benign Het
Bach2 T A 4: 32,563,150 L539H probably damaging Het
Birc6 A G 17: 74,655,178 K3929R probably damaging Het
C1qtnf2 A G 11: 43,491,321 D320G probably benign Het
Cbr2 A T 11: 120,730,452 H140Q probably benign Het
Cbs T C 17: 31,617,381 probably benign Het
Cdc42bpg T C 19: 6,317,645 V1015A probably damaging Het
Cep104 T G 4: 153,984,943 M207R probably damaging Het
Chil6 A T 3: 106,405,958 M25K probably benign Het
Cln5 A G 14: 103,073,359 D154G probably damaging Het
Col4a1 C A 8: 11,209,650 G1341V probably damaging Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cx3cl1 A T 8: 94,777,306 probably benign Het
Cyct T C 2: 76,354,168 K80E probably damaging Het
Dhx37 T C 5: 125,431,613 K86R probably benign Het
Dnah17 G A 11: 118,041,158 probably benign Het
Etl4 T C 2: 20,785,421 V628A probably benign Het
Fam234a T C 17: 26,218,189 E172G probably benign Het
Foxp2 C T 6: 15,379,831 probably benign Het
Frem1 A T 4: 82,998,930 F592Y probably damaging Het
Gm10259 T G 3: 25,212,529 noncoding transcript Het
Gm17521 C A X: 123,029,225 G149C unknown Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Grpel1 T A 5: 36,469,483 N36K probably benign Het
Hap1 G T 11: 100,356,021 D19E probably damaging Het
Mast4 G T 13: 102,738,811 H1350N probably damaging Het
Mrpl50 T C 4: 49,514,539 E44G probably damaging Het
Myg1 G C 15: 102,337,736 G349R probably damaging Het
Myh1 A G 11: 67,205,597 I301V probably benign Het
Ncapg2 A T 12: 116,407,318 probably benign Het
Ncor2 T C 5: 125,118,692 probably benign Het
Neo1 A G 9: 58,913,169 Y824H possibly damaging Het
Olfr99 T A 17: 37,280,249 Y57F probably damaging Het
Orc1 T A 4: 108,605,631 M635K probably damaging Het
Phip A G 9: 82,871,645 I1682T probably benign Het
Ppp2r1b A G 9: 50,862,494 N223S probably benign Het
Ralb A T 1: 119,471,717 C204S probably benign Het
Rgs12 G A 5: 34,966,015 V381M possibly damaging Het
Rsg1 C T 4: 141,218,589 R148C probably damaging Het
Rtkn2 A T 10: 67,997,626 probably null Het
Srrm3 A G 5: 135,857,214 D336G probably damaging Het
Stk11 T C 10: 80,127,948 probably null Het
Svep1 A G 4: 58,096,177 L1481P probably damaging Het
Tiam2 C G 17: 3,507,701 probably benign Het
Tmem59l A G 8: 70,487,301 L6S unknown Het
Tmprss11b T C 5: 86,661,590 T348A probably damaging Het
Ube3b C A 5: 114,399,951 Q368K probably damaging Het
Veph1 T A 3: 66,159,327 E413D possibly damaging Het
Vmn2r91 T G 17: 18,105,497 W126G probably damaging Het
Yrdc T A 4: 124,851,761 M1K probably null Het
Zfp445 T C 9: 122,853,077 M600V probably benign Het
Other mutations in Lpcat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Lpcat1 APN 13 73494828 missense probably damaging 0.98
IGL02869:Lpcat1 APN 13 73484298 missense probably damaging 1.00
R0064:Lpcat1 UTSW 13 73514466 missense probably damaging 1.00
R1666:Lpcat1 UTSW 13 73510123 critical splice donor site probably null
R3826:Lpcat1 UTSW 13 73489093 missense possibly damaging 0.89
R3830:Lpcat1 UTSW 13 73489093 missense possibly damaging 0.89
R4987:Lpcat1 UTSW 13 73489103 critical splice donor site probably null
R6298:Lpcat1 UTSW 13 73510955 missense possibly damaging 0.58
R7066:Lpcat1 UTSW 13 73511381 missense probably benign 0.00
R7165:Lpcat1 UTSW 13 73514530 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTTACAGGGTCGTGGACTTC -3'
(R):5'- TCTGCACATGACAGTACTGGG -3'

Sequencing Primer
(F):5'- TGCTCAAGGCCATCATGC -3'
(R):5'- TACTGGGGGACATGTCAGTAC -3'
Posted On2015-04-02