Incidental Mutation 'R3832:Kif26b'
ID274038
Institutional Source Beutler Lab
Gene Symbol Kif26b
Ensembl Gene ENSMUSG00000026494
Gene Namekinesin family member 26B
SynonymsD230039L06Rik, N-11 kinesin
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3832 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location178529125-178939200 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAAA to GAA at 178916616 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160789] [ENSMUST00000161017]
Predicted Effect probably null
Transcript: ENSMUST00000160789
SMART Domains Protein: ENSMUSP00000124608
Gene: ENSMUSG00000026494

DomainStartEndE-ValueType
KISc 1 362 2.48e-42 SMART
low complexity region 363 375 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
low complexity region 460 466 N/A INTRINSIC
low complexity region 560 600 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 1038 1048 N/A INTRINSIC
low complexity region 1294 1322 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161017
SMART Domains Protein: ENSMUSP00000124462
Gene: ENSMUSG00000026494

DomainStartEndE-ValueType
low complexity region 58 123 N/A INTRINSIC
low complexity region 144 155 N/A INTRINSIC
low complexity region 220 228 N/A INTRINSIC
Blast:KISc 365 446 4e-8 BLAST
KISc 448 809 2.48e-42 SMART
low complexity region 810 822 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 907 913 N/A INTRINSIC
low complexity region 1007 1047 N/A INTRINSIC
low complexity region 1099 1109 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1485 1495 N/A INTRINSIC
low complexity region 1741 1769 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162545
Meta Mutation Damage Score 0.656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality with impaired kidney development due to loss of cortical nephrogenic zone mesenchyme and failure of ureteric buds to invade and branch into the mesenchyme. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Kif26b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kif26b APN 1 178915648 missense probably damaging 1.00
IGL00425:Kif26b APN 1 178916301 missense probably damaging 0.96
IGL00952:Kif26b APN 1 178932205 missense probably damaging 1.00
IGL01100:Kif26b APN 1 178917244 missense probably benign
IGL01347:Kif26b APN 1 178870675 missense probably damaging 1.00
IGL01543:Kif26b APN 1 178678961 missense probably benign 0.41
IGL01938:Kif26b APN 1 178916038 missense probably damaging 0.99
IGL02100:Kif26b APN 1 178915947 missense probably damaging 0.99
IGL02262:Kif26b APN 1 178916068 missense probably benign 0.05
IGL02576:Kif26b APN 1 178916347 missense probably benign
IGL02673:Kif26b APN 1 178821605 missense probably damaging 1.00
IGL03078:Kif26b APN 1 178870726 missense probably damaging 1.00
IGL03155:Kif26b APN 1 178874128 missense probably damaging 1.00
IGL03157:Kif26b APN 1 178916365 missense probably damaging 1.00
IGL03162:Kif26b APN 1 178916932 missense probably benign
IGL03220:Kif26b APN 1 178864869 missense probably damaging 1.00
IGL03299:Kif26b APN 1 178821560 missense probably benign 0.09
IGL03368:Kif26b APN 1 178916208 missense probably damaging 1.00
IGL03370:Kif26b APN 1 178915381 missense probably benign 0.39
PIT4449001:Kif26b UTSW 1 178918086 missense probably damaging 1.00
R0142:Kif26b UTSW 1 178915389 missense probably damaging 1.00
R0621:Kif26b UTSW 1 178915653 missense probably benign 0.02
R0987:Kif26b UTSW 1 178821620 missense probably damaging 1.00
R1107:Kif26b UTSW 1 178917673 missense probably benign 0.03
R1367:Kif26b UTSW 1 178916463 missense probably damaging 1.00
R1386:Kif26b UTSW 1 178915644 missense probably benign
R1619:Kif26b UTSW 1 178916478 missense probably benign 0.00
R1664:Kif26b UTSW 1 178932139 missense probably damaging 1.00
R2240:Kif26b UTSW 1 178715923 missense probably benign 0.00
R2264:Kif26b UTSW 1 178928842 critical splice acceptor site probably null
R2443:Kif26b UTSW 1 178915014 missense probably damaging 0.99
R3023:Kif26b UTSW 1 178864868 missense probably damaging 0.99
R3744:Kif26b UTSW 1 178679030 missense probably benign 0.00
R3831:Kif26b UTSW 1 178916616 frame shift probably null
R3833:Kif26b UTSW 1 178916616 frame shift probably null
R3843:Kif26b UTSW 1 178928177 missense probably damaging 1.00
R4108:Kif26b UTSW 1 178916965 missense possibly damaging 0.88
R4181:Kif26b UTSW 1 178915426 missense probably damaging 0.98
R4551:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4552:Kif26b UTSW 1 178884035 missense probably damaging 1.00
R4597:Kif26b UTSW 1 178916793 missense probably damaging 1.00
R4599:Kif26b UTSW 1 178530459 missense unknown
R4610:Kif26b UTSW 1 178679355 missense probably damaging 1.00
R4746:Kif26b UTSW 1 178873981 nonsense probably null
R4873:Kif26b UTSW 1 178915327 missense probably benign 0.38
R4875:Kif26b UTSW 1 178915327 missense probably benign 0.38
R5015:Kif26b UTSW 1 178928330 missense probably damaging 0.99
R5060:Kif26b UTSW 1 178530630 missense unknown
R5301:Kif26b UTSW 1 178530668 missense unknown
R5368:Kif26b UTSW 1 178915884 missense probably damaging 1.00
R5387:Kif26b UTSW 1 178914876 missense probably benign 0.01
R5589:Kif26b UTSW 1 178916299 missense probably benign 0.05
R6150:Kif26b UTSW 1 178915546 missense probably damaging 1.00
R6259:Kif26b UTSW 1 178917405 missense probably damaging 0.97
R6355:Kif26b UTSW 1 178916178 missense probably damaging 1.00
R6408:Kif26b UTSW 1 178917568 missense probably damaging 1.00
R6488:Kif26b UTSW 1 178529573 missense unknown
R6546:Kif26b UTSW 1 178928306 missense probably damaging 1.00
R6702:Kif26b UTSW 1 178917287 missense possibly damaging 0.90
R6886:Kif26b UTSW 1 178874138 missense probably damaging 1.00
R6953:Kif26b UTSW 1 178874072 missense possibly damaging 0.89
R7262:Kif26b UTSW 1 178917654 missense possibly damaging 0.84
R7291:Kif26b UTSW 1 178679046 missense possibly damaging 0.86
R7346:Kif26b UTSW 1 178530741 missense probably damaging 1.00
R7383:Kif26b UTSW 1 178530710 missense probably damaging 1.00
R7448:Kif26b UTSW 1 178914774 missense probably damaging 1.00
X0021:Kif26b UTSW 1 178928159 missense probably damaging 1.00
X0024:Kif26b UTSW 1 178679082 missense probably benign 0.14
X0025:Kif26b UTSW 1 178915266 nonsense probably null
X0025:Kif26b UTSW 1 178915383 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAGGCCATGGTCACCATCTC -3'
(R):5'- CGTTATCAGTCCCTTGAAAGGCG -3'

Sequencing Primer
(F):5'- TGGTCACCATCTCCAACACAG -3'
(R):5'- TGCTCAGCCTGTTGCCTGAG -3'
Posted On2015-04-02