Incidental Mutation 'R3832:Cacnb2'
ID274040
Institutional Source Beutler Lab
Gene Symbol Cacnb2
Ensembl Gene ENSMUSG00000057914
Gene Namecalcium channel, voltage-dependent, beta 2 subunit
SynonymsCchb2, Cavbeta2
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location14603088-14987908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14981425 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 338 (I338F)
Ref Sequence ENSEMBL: ENSMUSP00000141221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114719] [ENSMUST00000114723] [ENSMUST00000193800]
Predicted Effect probably damaging
Transcript: ENSMUST00000114719
AA Change: I344F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110367
Gene: ENSMUSG00000057914
AA Change: I344F

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 24 65 1.7e-26 PFAM
SH3 69 133 2.42e-2 SMART
low complexity region 149 161 N/A INTRINSIC
GuKc 232 414 6.11e-38 SMART
low complexity region 419 448 N/A INTRINSIC
low complexity region 546 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114723
AA Change: I388F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110371
Gene: ENSMUSG00000057914
AA Change: I388F

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 68 109 2.7e-25 PFAM
SH3 113 177 2.42e-2 SMART
low complexity region 193 205 N/A INTRINSIC
GuKc 276 458 6.11e-38 SMART
low complexity region 463 492 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193262
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193452
Predicted Effect probably benign
Transcript: ENSMUST00000193522
Predicted Effect probably damaging
Transcript: ENSMUST00000193800
AA Change: I338F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141221
Gene: ENSMUSG00000057914
AA Change: I338F

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 18 59 3.2e-27 PFAM
SH3 63 127 2.42e-2 SMART
low complexity region 143 155 N/A INTRINSIC
GuKc 226 408 6.11e-38 SMART
low complexity region 413 442 N/A INTRINSIC
low complexity region 540 555 N/A INTRINSIC
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a voltage-dependent calcium channel protein that is a member of the voltage-gated calcium channel superfamily. The gene product was originally identified as an antigen target in Lambert-Eaton myasthenic syndrome, an autoimmune disorder. Mutations in this gene are associated with Brugada syndrome. Alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality at E10.5 with growth retardation, abnormal yolk vasculature and abnormal cardiac development and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Cacnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cacnb2 APN 2 14984270 missense possibly damaging 0.95
IGL01806:Cacnb2 APN 2 14614268 missense probably damaging 1.00
IGL01939:Cacnb2 APN 2 14971569 missense probably benign 0.16
IGL02941:Cacnb2 APN 2 14958829 missense probably benign 0.00
PIT1430001:Cacnb2 UTSW 2 14971601 nonsense probably null
PIT4498001:Cacnb2 UTSW 2 14874819 nonsense probably null
PIT4508001:Cacnb2 UTSW 2 14984419 missense probably benign 0.00
R0095:Cacnb2 UTSW 2 14958775 missense probably damaging 1.00
R0731:Cacnb2 UTSW 2 14985706 missense possibly damaging 0.95
R1521:Cacnb2 UTSW 2 14614352 missense probably benign 0.18
R1829:Cacnb2 UTSW 2 14985964 missense possibly damaging 0.89
R2174:Cacnb2 UTSW 2 14958767 missense probably benign 0.21
R2471:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R2473:Cacnb2 UTSW 2 14984314 missense probably damaging 1.00
R3801:Cacnb2 UTSW 2 14824263 missense possibly damaging 0.85
R3831:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3833:Cacnb2 UTSW 2 14981425 missense probably damaging 1.00
R3981:Cacnb2 UTSW 2 14604503 missense probably benign
R4231:Cacnb2 UTSW 2 14981440 missense probably damaging 1.00
R4426:Cacnb2 UTSW 2 14975215 nonsense probably null
R4569:Cacnb2 UTSW 2 14986000 missense possibly damaging 0.94
R4815:Cacnb2 UTSW 2 14874780 missense probably damaging 1.00
R4911:Cacnb2 UTSW 2 14981340 missense possibly damaging 0.83
R5189:Cacnb2 UTSW 2 14986038 missense possibly damaging 0.56
R6114:Cacnb2 UTSW 2 14975201 missense possibly damaging 0.88
R6158:Cacnb2 UTSW 2 14985601 missense possibly damaging 0.62
R6530:Cacnb2 UTSW 2 14975167 missense probably damaging 1.00
R6612:Cacnb2 UTSW 2 14975149 missense probably benign 0.41
R6882:Cacnb2 UTSW 2 14824299 missense probably benign 0.00
R6889:Cacnb2 UTSW 2 14986015 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- AGTGCGCCACTTCATTTCAG -3'
(R):5'- TCTGAGCCACACATTAACCATG -3'

Sequencing Primer
(F):5'- CAGCTTCCTGTAGTTTCAAATGTG -3'
(R):5'- AACCATGCTCATTCTTCTTCTAAAAC -3'
Posted On2015-04-02