Incidental Mutation 'R3832:Bcar3'
ID274044
Institutional Source Beutler Lab
Gene Symbol Bcar3
Ensembl Gene ENSMUSG00000028121
Gene Namebreast cancer anti-estrogen resistance 3
SynonymsAND-34
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122294136-122530191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122426649 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000029766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029766]
Predicted Effect probably damaging
Transcript: ENSMUST00000029766
AA Change: D65G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029766
Gene: ENSMUSG00000028121
AA Change: D65G

DomainStartEndE-ValueType
low complexity region 126 145 N/A INTRINSIC
SH2 146 234 3.17e-21 SMART
low complexity region 395 406 N/A INTRINSIC
RasGEF 539 814 2.55e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196134
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200544
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Breast tumors are initially dependent on estrogens for growth and progression and can be inhibited by anti-estrogens such as tamoxifen. However, breast cancers progress to become anti-estrogen resistant. Breast cancer anti-estrogen resistance gene 3 was identified in the search for genes involved in the development of estrogen resistance. The gene encodes a component of intracellular signal transduction that causes estrogen-independent proliferation in human breast cancer cells. The protein contains a putative src homology 2 (SH2) domain, a hall mark of cellular tyrosine kinase signaling molecules, and is partly homologous to the cell division cycle protein CDC48. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit cataracts due to rupture of the lens capsule and liquefaction of lens cortical fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Bcar3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Bcar3 APN 3 122512936 missense probably benign 0.36
IGL01372:Bcar3 APN 3 122523294 missense probably damaging 1.00
IGL02681:Bcar3 APN 3 122512768 unclassified probably null
IGL03403:Bcar3 APN 3 122512969 missense probably benign 0.01
R0408:Bcar3 UTSW 3 122508384 missense probably damaging 0.98
R0531:Bcar3 UTSW 3 122426499 missense probably benign 0.00
R0798:Bcar3 UTSW 3 122525299 missense probably benign 0.01
R1445:Bcar3 UTSW 3 122523191 missense probably damaging 0.98
R1892:Bcar3 UTSW 3 122508136 missense probably benign 0.00
R2138:Bcar3 UTSW 3 122512996 missense probably damaging 1.00
R3236:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R3237:Bcar3 UTSW 3 122524996 missense probably benign 0.02
R4801:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R4802:Bcar3 UTSW 3 122529594 missense probably benign 0.22
R5342:Bcar3 UTSW 3 122426649 missense probably damaging 1.00
R5364:Bcar3 UTSW 3 122529632 missense probably benign 0.41
R5560:Bcar3 UTSW 3 122426575 missense possibly damaging 0.92
R5714:Bcar3 UTSW 3 122455087 missense possibly damaging 0.88
R5716:Bcar3 UTSW 3 122512915 missense probably damaging 1.00
R5944:Bcar3 UTSW 3 122523283 missense probably benign
R6478:Bcar3 UTSW 3 122426576 missense probably benign 0.04
R6615:Bcar3 UTSW 3 122426633 missense probably benign 0.00
R6996:Bcar3 UTSW 3 122508384 missense possibly damaging 0.95
R7272:Bcar3 UTSW 3 122508396 missense possibly damaging 0.92
R7308:Bcar3 UTSW 3 122508493 missense probably benign 0.00
R7353:Bcar3 UTSW 3 122512692 missense probably benign 0.00
R7465:Bcar3 UTSW 3 122523230 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTTCCCAGAAACATGCCTGTG -3'
(R):5'- GGACCCCAGGCTTTACATAC -3'

Sequencing Primer
(F):5'- ACATGCCTGTGAATCACCAGTTC -3'
(R):5'- GTGGGACTCATATAGCTTCGCATAC -3'
Posted On2015-04-02