Incidental Mutation 'R3832:Peak1'
ID274066
Institutional Source Beutler Lab
Gene Symbol Peak1
Ensembl Gene ENSMUSG00000074305
Gene Namepseudopodium-enriched atypical kinase 1
SynonymsC230081A13Rik, NKF3 kinase family member, 1110049L02Rik
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56201126-56418067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56258383 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 754 (S754G)
Ref Sequence ENSEMBL: ENSMUSP00000109901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061552] [ENSMUST00000186735]
Predicted Effect probably benign
Transcript: ENSMUST00000061552
AA Change: S754G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109901
Gene: ENSMUSG00000074305
AA Change: S754G

DomainStartEndE-ValueType
low complexity region 247 259 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 498 509 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
low complexity region 860 878 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Pfam:Pkinase_Tyr 1437 1649 1.5e-6 PFAM
Pfam:Pkinase 1440 1651 2.3e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181444
Predicted Effect probably benign
Transcript: ENSMUST00000186735
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a non-receptor tyrosine kinase that is a member of the new kinase family three (NFK3) family. In migrating cells, the encoded protein is associated with the actin cytoskeleton and focal adhesions and promotes developing focal adhesion elongation. This protein may play a role in the regulation of cell migration, proliferation and cancer metastasis. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Peak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Peak1 APN 9 56227326 missense probably damaging 1.00
IGL00544:Peak1 APN 9 56259978 missense probably damaging 1.00
IGL01141:Peak1 APN 9 56258527 missense probably benign 0.01
IGL01743:Peak1 APN 9 56259202 missense probably damaging 1.00
IGL01781:Peak1 APN 9 56260065 missense possibly damaging 0.92
IGL01885:Peak1 APN 9 56260104 missense probably damaging 1.00
IGL01941:Peak1 APN 9 56258775 missense probably damaging 1.00
IGL02455:Peak1 APN 9 56227473 missense possibly damaging 0.89
IGL02719:Peak1 APN 9 56227206 missense probably damaging 1.00
IGL03247:Peak1 APN 9 56257930 missense probably damaging 1.00
IGL03259:Peak1 APN 9 56259967 missense probably damaging 1.00
R0060:Peak1 UTSW 9 56227823 missense probably damaging 1.00
R0087:Peak1 UTSW 9 56258325 missense probably damaging 1.00
R0480:Peak1 UTSW 9 56258632 missense probably benign 0.00
R0569:Peak1 UTSW 9 56260089 missense probably damaging 1.00
R0605:Peak1 UTSW 9 56227098 splice site probably benign
R0865:Peak1 UTSW 9 56257832 missense probably benign 0.02
R1117:Peak1 UTSW 9 56258418 missense probably benign 0.05
R1922:Peak1 UTSW 9 56206687 missense probably damaging 1.00
R1959:Peak1 UTSW 9 56206789 missense probably damaging 1.00
R2069:Peak1 UTSW 9 56258759 missense probably damaging 1.00
R2083:Peak1 UTSW 9 56258949 missense probably damaging 1.00
R2154:Peak1 UTSW 9 56207212 missense probably damaging 1.00
R2407:Peak1 UTSW 9 56259226 missense probably damaging 1.00
R3938:Peak1 UTSW 9 56260365 missense probably benign 0.01
R3964:Peak1 UTSW 9 56259979 missense probably damaging 1.00
R4192:Peak1 UTSW 9 56258741 missense probably damaging 1.00
R4381:Peak1 UTSW 9 56258427 missense probably benign 0.34
R4869:Peak1 UTSW 9 56227592 missense probably benign 0.06
R4994:Peak1 UTSW 9 56241276 missense possibly damaging 0.65
R5062:Peak1 UTSW 9 56260289 missense probably damaging 1.00
R5435:Peak1 UTSW 9 56206486 missense probably damaging 0.98
R5632:Peak1 UTSW 9 56257774 missense probably damaging 1.00
R5643:Peak1 UTSW 9 56258755 missense probably damaging 0.99
R5880:Peak1 UTSW 9 56207610 missense probably damaging 1.00
R5898:Peak1 UTSW 9 56207338 missense probably benign 0.19
R5986:Peak1 UTSW 9 56259442 missense probably benign 0.00
R6109:Peak1 UTSW 9 56259283 missense probably benign 0.01
R6284:Peak1 UTSW 9 56260296 missense probably benign 0.10
R6347:Peak1 UTSW 9 56258211 missense probably benign 0.00
R6374:Peak1 UTSW 9 56257666 missense probably damaging 1.00
R6471:Peak1 UTSW 9 56258259 missense probably damaging 1.00
R6717:Peak1 UTSW 9 56207239 missense probably benign 0.00
R7033:Peak1 UTSW 9 56259707 missense probably damaging 1.00
R7039:Peak1 UTSW 9 56257809 missense probably benign 0.01
R7100:Peak1 UTSW 9 56259393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCCCCACTAGACTGAGATG -3'
(R):5'- GTTTTCCAACAGCACAGAGC -3'

Sequencing Primer
(F):5'- TCCCCACTAGACTGAGATGTAAAAAG -3'
(R):5'- GCGGAAAAGAGGCTCAGTAG -3'
Posted On2015-04-02