Incidental Mutation 'R3832:Tekt1'
ID274074
Institutional Source Beutler Lab
Gene Symbol Tekt1
Ensembl Gene ENSMUSG00000020799
Gene Nametektin 1
SynonymsMT14
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72344722-72362442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72354819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 170 (N170S)
Ref Sequence ENSEMBL: ENSMUSP00000104143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021155] [ENSMUST00000108502] [ENSMUST00000108503]
Predicted Effect probably benign
Transcript: ENSMUST00000021155
AA Change: N170S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000021155
Gene: ENSMUSG00000020799
AA Change: N170S

DomainStartEndE-ValueType
Pfam:Tektin 16 398 1.3e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108502
AA Change: N170S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104142
Gene: ENSMUSG00000020799
AA Change: N170S

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108503
AA Change: N170S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104143
Gene: ENSMUSG00000020799
AA Change: N170S

DomainStartEndE-ValueType
Pfam:Tektin 16 399 5.5e-152 PFAM
Meta Mutation Damage Score 0.004 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. This gene is predominantly expressed in the testis and in mouse, tektin 1 mRNA was localized to the spermatocytes and round spermatids in the seminiferous tubules, indicating that it may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Zp1 T C 19: 10,916,524 D439G probably damaging Het
Other mutations in Tekt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4544001:Tekt1 UTSW 11 72354834 missense probably damaging 1.00
R0463:Tekt1 UTSW 11 72351952 missense probably damaging 1.00
R0531:Tekt1 UTSW 11 72345594 missense possibly damaging 0.67
R1190:Tekt1 UTSW 11 72355213 missense probably damaging 1.00
R1908:Tekt1 UTSW 11 72351935 missense probably benign 0.41
R3783:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3784:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3785:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3787:Tekt1 UTSW 11 72344894 missense probably damaging 1.00
R3831:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3833:Tekt1 UTSW 11 72354819 missense probably benign 0.03
R3916:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R3917:Tekt1 UTSW 11 72345748 missense possibly damaging 0.83
R5645:Tekt1 UTSW 11 72351837 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCTCTAGGATGCTTCCCTTG -3'
(R):5'- TCCAGTTTGGCAGAGGATTTC -3'

Sequencing Primer
(F):5'- CCTTGGCCCTGTCAGATTGATAG -3'
(R):5'- TTGGTCTCCAAGCATCATCTGG -3'
Posted On2015-04-02