Incidental Mutation 'R3832:Zp1'
ID274086
Institutional Source Beutler Lab
Gene Symbol Zp1
Ensembl Gene ENSMUSG00000024734
Gene Namezona pellucida glycoprotein 1
Synonyms
MMRRC Submission 040887-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3832 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10914287-10920632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10916524 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 439 (D439G)
Ref Sequence ENSEMBL: ENSMUSP00000025641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025641] [ENSMUST00000168708]
Predicted Effect probably damaging
Transcript: ENSMUST00000025641
AA Change: D439G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025641
Gene: ENSMUSG00000024734
AA Change: D439G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 184 199 N/A INTRINSIC
PD 226 269 2.33e-11 SMART
ZP 271 542 1.55e-102 SMART
low complexity region 580 589 N/A INTRINSIC
transmembrane domain 591 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168708
SMART Domains Protein: ENSMUSP00000128543
Gene: ENSMUSG00000024734

DomainStartEndE-ValueType
Pfam:Zona_pellucida 3 61 5.6e-8 PFAM
Meta Mutation Damage Score 0.572 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene ensures the structural integrity of the zona pellucida. Mutations in this gene are a cause of oocyte maturation defect and infertility. [provided by RefSeq, May 2014]
PHENOTYPE: Female homozygous mutants produce oocytes with abnormal zona pellucida. Fecunditiy is significantly reduced, probably due to precocious hatching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 A C 15: 94,331,458 C927G probably damaging Het
Afdn T A 17: 13,896,174 D190E probably benign Het
Aldh1a7 T C 19: 20,708,238 Y316C probably damaging Het
Arhgef38 T C 3: 133,206,925 R118G possibly damaging Het
BC049730 T A 7: 24,714,287 S243T probably benign Het
Bcar3 A G 3: 122,426,649 D65G probably damaging Het
Cacna1i T C 15: 80,356,187 F370S probably damaging Het
Cacnb2 A T 2: 14,981,425 I338F probably damaging Het
Cblc T C 7: 19,792,172 M238V probably damaging Het
Ccdc3 A G 2: 5,229,142 N259S probably benign Het
Cep55 A G 19: 38,053,112 probably benign Het
Col6a1 T C 10: 76,711,117 D757G unknown Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyb5d2 G T 11: 72,795,523 S80R possibly damaging Het
Cyfip2 T C 11: 46,261,506 D485G probably benign Het
Cyp27b1 G T 10: 127,051,060 V382L probably damaging Het
Erich3 G A 3: 154,762,361 V817M probably damaging Het
Gdf6 T C 4: 9,844,568 S31P probably benign Het
Gtsf1 T C 15: 103,425,475 I25V probably damaging Het
Hephl1 T C 9: 15,069,748 E796G probably damaging Het
Iglv2 A T 16: 19,260,843 M1K probably null Het
Kif26b GAAA GAA 1: 178,916,616 probably null Het
Klhl28 C A 12: 64,951,421 G433V probably damaging Het
Lipn T C 19: 34,069,533 probably null Het
Mapk7 A G 11: 61,489,854 S641P possibly damaging Het
Med22 A G 2: 26,910,367 S17P probably damaging Het
Olfr126 T C 17: 37,851,180 V196A probably benign Het
Olfr301 A T 7: 86,413,193 Y277F probably damaging Het
Otud1 G C 2: 19,658,140 A27P possibly damaging Het
Pcdhga6 A T 18: 37,708,426 N400Y probably damaging Het
Pdgfd T C 9: 6,359,762 S278P probably damaging Het
Pdzd7 A T 19: 45,040,254 V150E probably damaging Het
Peak1 T C 9: 56,258,383 S754G probably benign Het
Phf14 A G 6: 11,933,874 probably null Het
Phlpp1 G A 1: 106,392,597 E1441K probably damaging Het
Piezo2 A G 18: 63,081,662 probably null Het
Pikfyve G A 1: 65,244,420 V739I probably damaging Het
Plcg1 T G 2: 160,754,437 M651R possibly damaging Het
Prex2 T C 1: 11,156,364 probably benign Het
Pus3 G C 9: 35,566,578 G369R probably benign Het
Rab11fip1 G A 8: 27,152,746 T675I probably benign Het
Scarf1 T C 11: 75,515,252 C121R probably damaging Het
Sco1 T C 11: 67,053,779 V76A probably damaging Het
Slc39a8 T A 3: 135,849,133 C113S probably damaging Het
Slit3 A T 11: 35,688,682 S1229C probably null Het
Snd1 G T 6: 28,531,404 probably benign Het
Tbc1d9 A G 8: 83,233,663 S182G probably damaging Het
Tecta A C 9: 42,339,033 F1816C probably damaging Het
Tekt1 T C 11: 72,354,819 N170S probably benign Het
Trim47 T C 11: 116,107,957 T279A probably benign Het
Ttll4 A G 1: 74,686,391 K653E probably damaging Het
Vcam1 T C 3: 116,114,491 T641A possibly damaging Het
Vmn1r16 A G 6: 57,323,227 F137L probably benign Het
Vmn2r17 T A 5: 109,428,396 W378R probably damaging Het
Zfp777 T C 6: 48,044,215 T158A probably benign Het
Other mutations in Zp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zp1 APN 19 10918777 missense probably damaging 1.00
IGL01504:Zp1 APN 19 10919011 missense probably damaging 0.99
IGL02260:Zp1 APN 19 10916714 unclassified probably benign
IGL02465:Zp1 APN 19 10920487 missense probably benign 0.09
IGL02634:Zp1 APN 19 10919507 unclassified probably benign
IGL02714:Zp1 APN 19 10918612 missense probably damaging 1.00
IGL03234:Zp1 APN 19 10914823 splice site probably benign
IGL03404:Zp1 APN 19 10914461 unclassified probably benign
R0504:Zp1 UTSW 19 10916207 missense probably damaging 0.98
R0554:Zp1 UTSW 19 10920562 missense probably benign 0.29
R1028:Zp1 UTSW 19 10918911 missense probably benign 0.01
R1279:Zp1 UTSW 19 10918577 missense probably damaging 1.00
R1460:Zp1 UTSW 19 10918878 missense probably benign
R3425:Zp1 UTSW 19 10918592 missense probably benign 0.00
R4420:Zp1 UTSW 19 10914760 splice site probably null
R4669:Zp1 UTSW 19 10918905 missense probably benign 0.31
R4849:Zp1 UTSW 19 10918834 missense possibly damaging 0.90
R5134:Zp1 UTSW 19 10920562 missense probably benign 0.29
R5170:Zp1 UTSW 19 10920554 missense possibly damaging 0.56
R5510:Zp1 UTSW 19 10919405 missense probably damaging 1.00
R6284:Zp1 UTSW 19 10916503 missense probably damaging 1.00
R6307:Zp1 UTSW 19 10916720 missense probably null 0.45
R6378:Zp1 UTSW 19 10914853 missense probably benign 0.15
R6608:Zp1 UTSW 19 10918980 missense possibly damaging 0.93
R6697:Zp1 UTSW 19 10914835 missense probably benign 0.05
R6862:Zp1 UTSW 19 10916513 missense possibly damaging 0.84
R7054:Zp1 UTSW 19 10918740 missense probably damaging 0.98
R7253:Zp1 UTSW 19 10916569 missense probably damaging 0.99
R7483:Zp1 UTSW 19 10917916 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGAGAAGTCCAGAAGCCTCTTTAAG -3'
(R):5'- TGTGACTCAATCTGGACCCC -3'

Sequencing Primer
(F):5'- CTCTTTAAGGAGGCGTGGCAG -3'
(R):5'- ACTCAATCTGGACCCCTGAGG -3'
Posted On2015-04-02