Mutagenetix > Incidental Mutation

Incidental Mutation 'R3812:Metap2'

274107

Institutional Source

Beutler Lab

Gene Symbol

Metap2

Ensembl Gene

ENSMUSG00000036112

Gene Name

methionine aminopeptidase 2

Synonyms

eIF-2-associated p67, 4930584B20Rik, A930035J23Rik, p67

MMRRC Submission

040768-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3812 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93694351-93732952 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 93706026 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 252 (L252*)

Ref Sequence

ENSEMBL: ENSMUSP00000138083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047910] [ENSMUST00000180688] [ENSMUST00000180840] [ENSMUST00000181091] [ENSMUST00000181217] [ENSMUST00000181470]

AlphaFold

O08663

Predicted Effect

probably null
Transcript: ENSMUST00000047910
AA Change: L242*

SMART Domains

Protein: ENSMUSP00000048285
Gene: ENSMUSG00000036112
AA Change: L242*

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
low complexity region	77	108	N/A	INTRINSIC
Pfam:Peptidase_M24	167	466	1.2e-47	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000180375
AA Change: L215*

Predicted Effect

probably null
Transcript: ENSMUST00000180392
AA Change: L99*

Predicted Effect

probably benign
Transcript: ENSMUST00000180688

SMART Domains

Protein: ENSMUSP00000137652
Gene: ENSMUSG00000036112

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
low complexity region	76	107	N/A	INTRINSIC
Pfam:Peptidase_M24	166	233	2e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000180840
AA Change: L242*

SMART Domains

Protein: ENSMUSP00000138006
Gene: ENSMUSG00000036112
AA Change: L242*

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
low complexity region	77	108	N/A	INTRINSIC
Pfam:Peptidase_M24	167	466	2.8e-50	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000181091
AA Change: L219*

SMART Domains

Protein: ENSMUSP00000137904
Gene: ENSMUSG00000036112
AA Change: L219*

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
low complexity region	77	108	N/A	INTRINSIC
Pfam:Peptidase_M24	144	443	2.2e-50	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000181217
AA Change: L252*

SMART Domains

Protein: ENSMUSP00000138083
Gene: ENSMUSG00000036112
AA Change: L252*

Domain	Start	End	E-Value	Type
low complexity region	24	48	N/A	INTRINSIC
low complexity region	77	108	N/A	INTRINSIC
Pfam:Peptidase_M24	177	476	2.7e-50	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181442

Predicted Effect

probably benign
Transcript: ENSMUST00000181470

SMART Domains

Protein: ENSMUSP00000138050
Gene: ENSMUSG00000036112

Domain	Start	End	E-Value	Type
Pfam:Peptidase_M24	1	97	6.6e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216232

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (28/28)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methionyl aminopeptidase family. The encoded protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent proteins. Increased expression of this gene is associated with various forms of cancer, and the anti-cancer drugs fumagillin and ovalicin inhibit the protein by irreversibly binding to its active site. Inhibitors of this gene have also been shown to be effective for the treatment of obesity. A pseudogene of this gene is located on chromosome 2. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality around E8.5, smaller size, failure to gastrulate, reduced cell proliferation and absence of a distinct mesoderm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid2	T	C	15: 96,186,967 (GRCm39)	V73A	probably benign	Het
Bpifb2	T	A	2: 153,733,871 (GRCm39)	D404E	probably benign	Het
Ccdc150	A	G	1: 54,407,469 (GRCm39)	M1082V	probably benign	Het
Cyp4a31	T	C	4: 115,423,706 (GRCm39)	S137P	probably benign	Het
Cyp4f15	A	G	17: 32,905,151 (GRCm39)	I45V	probably benign	Het
Fbxw28	C	A	9: 109,167,598 (GRCm39)	C53F	possibly damaging	Het
Galntl5	T	C	5: 25,391,178 (GRCm39)	F26L	probably benign	Het
Gm9637	A	T	14: 19,402,398 (GRCm38)		noncoding transcript	Het
Lcmt2	G	A	2: 120,969,187 (GRCm39)	A632V	probably benign	Het
Myo1a	A	G	10: 127,543,284 (GRCm39)	N180S	possibly damaging	Het
Nlrp4a	T	C	7: 26,149,118 (GRCm39)	W242R	probably benign	Het
Or4c12b	T	A	2: 89,647,395 (GRCm39)	S242T	probably damaging	Het
Or5w18	C	T	2: 87,633,396 (GRCm39)	S221F	possibly damaging	Het
Or5w19	T	A	2: 87,698,745 (GRCm39)	S137T	probably damaging	Het
Otogl	A	G	10: 107,735,332 (GRCm39)	Y151H	probably damaging	Het
Pkd1	T	C	17: 24,784,615 (GRCm39)	V387A	probably benign	Het
Polm	A	G	11: 5,779,512 (GRCm39)	F429L	possibly damaging	Het
Sco2	T	C	15: 89,257,882 (GRCm39)		probably benign	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Sorbs2	A	G	8: 46,216,067 (GRCm39)	T105A	probably benign	Het
Syt10	A	T	15: 89,675,000 (GRCm39)	C449S	probably benign	Het
Top2b	T	G	14: 16,409,189 (GRCm38)	I777M	probably damaging	Het
Txndc5	T	C	13: 38,707,381 (GRCm39)	K99E	probably benign	Het
Usp34	T	A	11: 23,414,517 (GRCm39)	F2820Y	possibly damaging	Het
Vmn1r170	T	C	7: 23,305,717 (GRCm39)	S40P	probably damaging	Het
Zfp292	A	T	4: 34,810,326 (GRCm39)	L906Q	probably damaging	Het

Other mutations in Metap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01671:Metap2	APN	10	93,707,340 (GRCm39)	splice site	probably benign
IGL02553:Metap2	APN	10	93,701,311 (GRCm39)	missense	probably damaging	1.00
R0212:Metap2	UTSW	10	93,697,242 (GRCm39)	missense	probably damaging	1.00
R0749:Metap2	UTSW	10	93,715,429 (GRCm39)	missense	probably benign	0.43
R1183:Metap2	UTSW	10	93,706,046 (GRCm39)	missense	probably damaging	1.00
R1459:Metap2	UTSW	10	93,704,811 (GRCm39)	missense	probably damaging	1.00
R1468:Metap2	UTSW	10	93,707,345 (GRCm39)	splice site	probably null
R1468:Metap2	UTSW	10	93,707,345 (GRCm39)	splice site	probably null
R1646:Metap2	UTSW	10	93,706,059 (GRCm39)	missense	probably damaging	1.00
R3810:Metap2	UTSW	10	93,706,026 (GRCm39)	nonsense	probably null
R3811:Metap2	UTSW	10	93,706,026 (GRCm39)	nonsense	probably null
R4174:Metap2	UTSW	10	93,715,427 (GRCm39)	missense	possibly damaging	0.68
R4801:Metap2	UTSW	10	93,704,757 (GRCm39)	missense	probably damaging	1.00
R4802:Metap2	UTSW	10	93,704,757 (GRCm39)	missense	probably damaging	1.00
R4983:Metap2	UTSW	10	93,725,462 (GRCm39)	missense	possibly damaging	0.86
R5030:Metap2	UTSW	10	93,715,539 (GRCm39)	splice site	probably null
R5276:Metap2	UTSW	10	93,704,794 (GRCm39)	missense	probably benign	0.02
R5276:Metap2	UTSW	10	93,704,784 (GRCm39)	missense	possibly damaging	0.93
R8191:Metap2	UTSW	10	93,701,267 (GRCm39)	critical splice donor site	probably null
R8311:Metap2	UTSW	10	93,697,384 (GRCm39)	missense	possibly damaging	0.71
R9622:Metap2	UTSW	10	93,707,366 (GRCm39)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCCAGTACAGCTTTAGAGAAGG -3'
(R):5'- TGAGCTCCGCATTCAGAAAG -3'

Sequencing Primer
(F):5'- TACAGCTTTAGAGAAGGAGCCAAG -3'
(R):5'- TGAGCTCCGCATTCAGAAAGTACTC -3'

Posted On

2015-04-02