Incidental Mutation 'R3813:Olfr1161'
ID274130
Institutional Source Beutler Lab
Gene Symbol Olfr1161
Ensembl Gene ENSMUSG00000045150
Gene Nameolfactory receptor 1161
SynonymsMOR174-2, GA_x6K02T2Q125-49516664-49517629
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88022774-88028252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88024761 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 13 (F13S)
Ref Sequence ENSEMBL: ENSMUSP00000150220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054845] [ENSMUST00000214438] [ENSMUST00000217006]
Predicted Effect probably damaging
Transcript: ENSMUST00000054845
AA Change: F13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060977
Gene: ENSMUSG00000045150
AA Change: F13S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 8.8e-52 PFAM
Pfam:7tm_1 42 291 9e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214438
AA Change: F13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217006
AA Change: F13S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Olfr1161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Olfr1161 APN 2 88025003 missense probably benign 0.23
IGL01564:Olfr1161 APN 2 88025304 missense probably benign 0.00
IGL01588:Olfr1161 APN 2 88025073 missense probably benign
R0268:Olfr1161 UTSW 2 88025468 missense probably damaging 0.99
R1587:Olfr1161 UTSW 2 88025133 missense probably damaging 1.00
R1995:Olfr1161 UTSW 2 88025672 missense probably benign 0.06
R2249:Olfr1161 UTSW 2 88025363 missense probably damaging 0.98
R4473:Olfr1161 UTSW 2 88025120 missense probably damaging 1.00
R4772:Olfr1161 UTSW 2 88024863 missense probably damaging 0.99
R4787:Olfr1161 UTSW 2 88024860 missense possibly damaging 0.79
R4870:Olfr1161 UTSW 2 88025460 missense probably damaging 1.00
R5260:Olfr1161 UTSW 2 88025474 missense probably benign 0.02
R5896:Olfr1161 UTSW 2 88025121 missense probably damaging 0.98
R6262:Olfr1161 UTSW 2 88025394 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTGTGATCTTCGTTTCTCTGACAC -3'
(R):5'- GCATCTTGGGAGCAATGACAG -3'

Sequencing Primer
(F):5'- TCGTTTCTCTGACACACCAAAATC -3'
(R):5'- TGACAGAGGAATAGCAGAAATCCAC -3'
Posted On2015-04-02