Incidental Mutation 'R3813:Lmo2'
ID274131
Institutional Source Beutler Lab
Gene Symbol Lmo2
Ensembl Gene ENSMUSG00000032698
Gene NameLIM domain only 2
SynonymsRbtn2, Rhom-2, Rbtn-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location103957986-103981878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103981062 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 147 (Y147H)
Ref Sequence ENSEMBL: ENSMUSP00000106769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111139] [ENSMUST00000111140] [ENSMUST00000111143] [ENSMUST00000123437] [ENSMUST00000138815] [ENSMUST00000156813] [ENSMUST00000170926]
Predicted Effect probably damaging
Transcript: ENSMUST00000111139
AA Change: Y147H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106769
Gene: ENSMUSG00000032698
AA Change: Y147H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 91 145 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111140
AA Change: Y219H

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106770
Gene: ENSMUSG00000032698
AA Change: Y219H

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 60 73 N/A INTRINSIC
LIM 99 153 4.03e-10 SMART
LIM 163 217 1.71e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111143
AA Change: Y211H

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106773
Gene: ENSMUSG00000032698
AA Change: Y211H

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
LIM 91 145 4.03e-10 SMART
LIM 155 209 1.71e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123437
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117703
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133210
Predicted Effect probably benign
Transcript: ENSMUST00000138815
SMART Domains Protein: ENSMUSP00000121927
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
Pfam:LIM 30 59 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156813
SMART Domains Protein: ENSMUSP00000122369
Gene: ENSMUSG00000032698

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 144 1.36e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170926
AA Change: Y149H

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128317
Gene: ENSMUSG00000032698
AA Change: Y149H

DomainStartEndE-ValueType
LIM 29 83 4.03e-10 SMART
LIM 93 147 1.71e-13 SMART
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LMO2 encodes a cysteine-rich, two LIM-domain protein that is required for yolk sac erythropoiesis. The LMO2 protein has a central and crucial role in hematopoietic development and is highly conserved. The LMO2 transcription start site is located approximately 25 kb downstream from the 11p13 T-cell translocation cluster (11p13 ttc), where a number T-cell acute lymphoblastic leukemia-specific translocations occur. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit lack of yolk sac erythropoiesis and die around embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Lmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Lmo2 APN 2 103981087 missense probably benign 0.21
R1983:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2013:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2014:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2131:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2132:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2133:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2233:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2235:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R2510:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R3038:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4058:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4059:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4448:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4450:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4544:Lmo2 UTSW 2 103976037 missense probably damaging 1.00
R4805:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4808:Lmo2 UTSW 2 103981062 missense probably damaging 0.99
R4975:Lmo2 UTSW 2 103976143 nonsense probably null
R5310:Lmo2 UTSW 2 103976100 missense probably damaging 0.98
R5823:Lmo2 UTSW 2 103981072 missense probably damaging 1.00
R6267:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6296:Lmo2 UTSW 2 103970601 missense possibly damaging 0.86
R6949:Lmo2 UTSW 2 103970673 start codon destroyed probably null 0.53
Predicted Primers PCR Primer
(F):5'- CTGTGCATCCTGTGACAAGC -3'
(R):5'- TTCTCTCTAAGGGCTGGTCC -3'

Sequencing Primer
(F):5'- ATCCTGTGACAAGCGGATC -3'
(R):5'- GAAGTCTCAGCCTTTGCATTATG -3'
Posted On2015-04-02