Incidental Mutation 'R3813:Rae1'
ID274135
Institutional Source Beutler Lab
Gene Symbol Rae1
Ensembl Gene ENSMUSG00000027509
Gene Nameribonucleic acid export 1
SynonymsD2Ertd342e, MNRP, MNRP41, 41
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location173000117-173015739 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 173006873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029013] [ENSMUST00000132212]
Predicted Effect probably benign
Transcript: ENSMUST00000029013
SMART Domains Protein: ENSMUSP00000029013
Gene: ENSMUSG00000027509

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
WD40 28 70 9.59e-1 SMART
WD40 76 114 9.82e-8 SMART
WD40 117 157 1.12e-2 SMART
Blast:WD40 160 195 2e-9 BLAST
Blast:WD40 202 244 8e-10 BLAST
WD40 250 301 1.14e-3 SMART
Blast:WD40 304 346 7e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124793
Predicted Effect probably benign
Transcript: ENSMUST00000132212
SMART Domains Protein: ENSMUSP00000121815
Gene: ENSMUSG00000027509

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
WD40 28 70 9.59e-1 SMART
WD40 76 114 9.82e-8 SMART
WD40 117 157 1.12e-2 SMART
Blast:WD40 160 195 6e-9 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in the Schizosaccharomyces pombe Rae1 and Saccharomyces cerevisiae Gle2 genes have been shown to result in accumulation of poly(A)-containing mRNA in the nucleus, suggesting that the encoded proteins are involved in RNA export. The protein encoded by this gene is a homolog of yeast Rae1. It contains four WD40 motifs, and has been shown to localize to distinct foci in the nucleoplasm, to the nuclear rim, and to meshwork-like structures throughout the cytoplasm. This gene is thought to be involved in nucleocytoplasmic transport, and in directly or indirectly attaching cytoplasmic mRNPs to the cytoskeleton. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are embryonic lethal. Heterozygous mutant mice exhibit a mitotic checkpoint defect and chromosome missegregation as well as an increased incidence of chemically-induced lung tumors; however, no spontaneous tumor formation or signs of early aging are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Rae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Rae1 APN 2 173006933 missense probably damaging 0.98
IGL02103:Rae1 APN 2 173003513 missense probably damaging 1.00
R0012:Rae1 UTSW 2 173002673 missense unknown
R0012:Rae1 UTSW 2 173002673 missense unknown
R0684:Rae1 UTSW 2 173005164 missense probably damaging 1.00
R1725:Rae1 UTSW 2 173006961 missense possibly damaging 0.77
R4537:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4540:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4710:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4731:Rae1 UTSW 2 173015392 utr 3 prime probably benign
R4979:Rae1 UTSW 2 173012608 unclassified probably benign
R6723:Rae1 UTSW 2 173012248 missense probably damaging 1.00
R7193:Rae1 UTSW 2 173008317 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGCCTGTTTCTCTGTGAGC -3'
(R):5'- GCACATGGGAGATTTGTGGC -3'

Sequencing Primer
(F):5'- AGCTCTGAGTGGTCACTTCCAG -3'
(R):5'- AGTGCTCTGAGAAATACTAGCAC -3'
Posted On2015-04-02