Incidental Mutation 'R3813:Manba'
ID274137
Institutional Source Beutler Lab
Gene Symbol Manba
Ensembl Gene ENSMUSG00000028164
Gene Namemannosidase, beta A, lysosomal
SynonymsB930014J03Rik, Bmn, 2410030O07Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location135485611-135571404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 135563262 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 643 (E643K)
Ref Sequence ENSEMBL: ENSMUSP00000029814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029814]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029814
AA Change: E643K

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029814
Gene: ENSMUSG00000028164
AA Change: E643K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_hydro_2_N 42 211 6.5e-11 PFAM
Pfam:Glyco_hydro_2_C 340 595 3.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153412
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyl hydrolase 2 family. The encoded protein localizes to the lysosome where it is the final exoglycosidase in the pathway for N-linked glycoprotein oligosaccharide catabolism. Mutations in this gene are associated with beta-mannosidosis, a lysosomal storage disease that has a wide spectrum of neurological involvement. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation results in no dysmorphology or overt neurological problems. Homozygotes show no beta-mannosidase activity and display consistent cytoplasmic vacuolation in the central nervous system and minimal vacuolation in most visceral organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Manba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Manba APN 3 135554780 nonsense probably null
IGL01443:Manba APN 3 135544828 missense probably damaging 1.00
IGL01796:Manba APN 3 135542389 missense probably damaging 1.00
IGL02396:Manba APN 3 135544764 missense probably damaging 1.00
IGL02471:Manba APN 3 135507008 splice site probably benign
IGL02809:Manba APN 3 135547560 missense probably damaging 1.00
IGL02861:Manba APN 3 135570263 missense probably benign 0.03
IGL02934:Manba APN 3 135544749 missense probably benign 0.00
IGL03130:Manba APN 3 135551159 missense probably damaging 1.00
IGL03237:Manba APN 3 135544751 missense probably damaging 1.00
IGL03342:Manba APN 3 135517987 missense possibly damaging 0.51
R0551:Manba UTSW 3 135517973 missense probably damaging 0.98
R1549:Manba UTSW 3 135544806 missense probably damaging 1.00
R1752:Manba UTSW 3 135506945 missense probably damaging 1.00
R1932:Manba UTSW 3 135544740 missense probably benign 0.01
R1991:Manba UTSW 3 135551191 missense probably benign 0.05
R3729:Manba UTSW 3 135554850 missense probably benign 0.00
R3731:Manba UTSW 3 135554850 missense probably benign 0.00
R4712:Manba UTSW 3 135544814 missense probably damaging 1.00
R5001:Manba UTSW 3 135567630 missense probably benign 0.00
R5481:Manba UTSW 3 135524556 missense possibly damaging 0.86
R5889:Manba UTSW 3 135524598 nonsense probably null
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6033:Manba UTSW 3 135549261 missense probably benign 0.00
R6434:Manba UTSW 3 135511973 splice site probably null
R6760:Manba UTSW 3 135542451 missense probably damaging 0.98
R7164:Manba UTSW 3 135542388 missense probably damaging 1.00
R7182:Manba UTSW 3 135567513 missense probably benign 0.06
R7184:Manba UTSW 3 135523154 missense possibly damaging 0.62
R7212:Manba UTSW 3 135567635 missense probably benign
R7266:Manba UTSW 3 135517912 missense probably damaging 1.00
R7271:Manba UTSW 3 135542376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCTTAATCAATGCAAGTCC -3'
(R):5'- TCTCCTTGCGGTAATCTGAC -3'

Sequencing Primer
(F):5'- GCAAGTCCAACACTCTAGTTTATC -3'
(R):5'- GACTCTTCAGGCTCTGCG -3'
Posted On2015-04-02