Incidental Mutation 'R3813:Plk3'
ID274138
Institutional Source Beutler Lab
Gene Symbol Plk3
Ensembl Gene ENSMUSG00000028680
Gene Namepolo like kinase 3
SynonymsCnk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117128655-117133963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117133450 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 89 (Y89C)
Ref Sequence ENSEMBL: ENSMUSP00000076130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062206] [ENSMUST00000076859] [ENSMUST00000144269]
Predicted Effect probably benign
Transcript: ENSMUST00000062206
SMART Domains Protein: ENSMUSP00000052243
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 121 217 3.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000076859
AA Change: Y89C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076130
Gene: ENSMUSG00000028680
AA Change: Y89C

DomainStartEndE-ValueType
low complexity region 9 36 N/A INTRINSIC
S_TKc 63 315 2.15e-96 SMART
Pfam:POLO_box 473 534 2.7e-16 PFAM
low complexity region 554 566 N/A INTRINSIC
Pfam:POLO_box 570 638 1.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126135
Predicted Effect probably benign
Transcript: ENSMUST00000144269
SMART Domains Protein: ENSMUSP00000122605
Gene: ENSMUSG00000047671

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
Pfam:Tctex-1 118 178 1.3e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147730
AA Change: Y67C
SMART Domains Protein: ENSMUSP00000120476
Gene: ENSMUSG00000028680
AA Change: Y67C

DomainStartEndE-ValueType
low complexity region 1 9 N/A INTRINSIC
S_TKc 42 294 2.15e-96 SMART
Pfam:POLO_box 435 496 5.3e-17 PFAM
low complexity region 516 528 N/A INTRINSIC
Pfam:POLO_box 532 600 2.3e-16 PFAM
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of the highly conserved polo-like kinase family of serine/threonine kinases. Members of this family are characterized by an amino-terminal catalytic domain and a carboxy-terminal bipartite polo box domain that functions as a substrate-binding motif and a cellular localization signal. Polo-like kinases have primarily been implicated in cell cycle regulation. In mouse, this protein that has been reported to localize to the nucleolus during interphase but is undetectable during mitosis, following nucleolus dissociation during prophase. The protein relocalizes to the nucleolus just prior to cytokinesis and peak levels are detected during G1 of interphase. This gene has been implicated in regulation of entry into S phase, with RNAi-induced depletion resulting in failure to re-enter the cell cycle. Mice deficient for this gene exhibit increased weight and tumor development at advanced age. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Aged mice homozygous for a null allele develop tumors in various organs at an accelerated rate while mouse embryonic fibroblasts are hypersensitive to the induction of HIF-1alpha under hypoxic conditions or by nickel and cobalt ion treatments. Homozygotes for another null allele are overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Plk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Plk3 APN 4 117132997 nonsense probably null
IGL01647:Plk3 APN 4 117130357 missense probably damaging 1.00
IGL02516:Plk3 APN 4 117131989 missense probably damaging 0.99
IGL03340:Plk3 APN 4 117132928 missense probably damaging 0.98
PIT4283001:Plk3 UTSW 4 117133292 missense probably damaging 1.00
R0421:Plk3 UTSW 4 117133444 missense probably damaging 1.00
R1074:Plk3 UTSW 4 117131758 missense probably damaging 1.00
R1612:Plk3 UTSW 4 117131807 missense probably damaging 1.00
R3901:Plk3 UTSW 4 117133436 missense probably benign 0.13
R5232:Plk3 UTSW 4 117129120 missense probably benign 0.04
R5486:Plk3 UTSW 4 117130403 nonsense probably null
R5655:Plk3 UTSW 4 117131480 missense probably damaging 1.00
R6612:Plk3 UTSW 4 117132737 nonsense probably null
R7127:Plk3 UTSW 4 117130570 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GGTCTCGGTGCAACTCTATC -3'
(R):5'- TACACCAAGGGTCGCTTGTTG -3'

Sequencing Primer
(F):5'- CTATCTCATTTAGGATCTGCGACAGG -3'
(R):5'- TCCGGGGTAGCGTTGAC -3'
Posted On2015-04-02