Incidental Mutation 'R3813:Hipk4'
ID274148
Institutional Source Beutler Lab
Gene Symbol Hipk4
Ensembl Gene ENSMUSG00000040424
Gene Namehomeodomain interacting protein kinase 4
SynonymsLOC233020
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27523267-27531175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 27523947 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 144 (L144S)
Ref Sequence ENSEMBL: ENSMUSP00000103990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037134] [ENSMUST00000065487] [ENSMUST00000098644] [ENSMUST00000108353] [ENSMUST00000108355] [ENSMUST00000125990]
Predicted Effect probably benign
Transcript: ENSMUST00000037134
SMART Domains Protein: ENSMUSP00000043175
Gene: ENSMUSG00000040424

DomainStartEndE-ValueType
SCOP:d1howa_ 1 142 8e-12 SMART
Blast:S_TKc 1 143 8e-99 BLAST
PDB:3ANR|D 1 155 1e-12 PDB
low complexity region 192 206 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065487
SMART Domains Protein: ENSMUSP00000066110
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 9.05e-5 PROSPERO
internal_repeat_2 317 428 7.28e-6 PROSPERO
internal_repeat_1 321 508 8.09e-9 PROSPERO
internal_repeat_1 503 779 8.09e-9 PROSPERO
internal_repeat_2 840 974 7.28e-6 PROSPERO
internal_repeat_3 1176 1268 9.05e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098644
SMART Domains Protein: ENSMUSP00000096241
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
low complexity region 179 232 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
internal_repeat_3 316 419 5.13e-5 PROSPERO
internal_repeat_2 317 428 3.79e-6 PROSPERO
internal_repeat_1 321 508 3.34e-9 PROSPERO
internal_repeat_1 503 779 3.34e-9 PROSPERO
internal_repeat_2 840 974 3.79e-6 PROSPERO
internal_repeat_3 1176 1268 5.13e-5 PROSPERO
low complexity region 1275 1314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108353
AA Change: L144S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103990
Gene: ENSMUSG00000040424
AA Change: L144S

DomainStartEndE-ValueType
S_TKc 11 347 9.31e-74 SMART
low complexity region 396 410 N/A INTRINSIC
low complexity region 593 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108355
SMART Domains Protein: ENSMUSP00000103992
Gene: ENSMUSG00000053198

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDZ 28 100 6.83e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125990
Meta Mutation Damage Score 0.0296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the homeodomain interacting protein kinase (HIPK) family of proteins. While other members of this family are found throughout vertebrates, this member is present only in mammals. Compared to other members of this family, the encoded protein lacks a nuclear localization signal and a C-terminal autoinhibitory domain. The encoded protein exhibits kinase activity and may phosphorylate the tumor suppressor protein p53. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Hipk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Hipk4 APN 7 27528543 nonsense probably null
IGL02712:Hipk4 APN 7 27528635 missense probably damaging 1.00
R2018:Hipk4 UTSW 7 27529004 missense probably damaging 1.00
R4796:Hipk4 UTSW 7 27528570 missense probably benign 0.00
R5121:Hipk4 UTSW 7 27529492 missense probably benign 0.02
R5738:Hipk4 UTSW 7 27528416 missense probably damaging 1.00
R5776:Hipk4 UTSW 7 27528980 missense probably damaging 1.00
R6142:Hipk4 UTSW 7 27529165 missense probably damaging 1.00
R6578:Hipk4 UTSW 7 27528387 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTATCCGCTTCCTTGAGT -3'
(R):5'- TGGGATACAGAAGACAGCCA -3'

Sequencing Primer
(F):5'- AAGTTCTACCTGGTCTTCGAGC -3'
(R):5'- GACAGCCAGAGAGCAGC -3'
Posted On2015-04-02