Incidental Mutation 'R3813:Kif7'
ID274149
Institutional Source Beutler Lab
Gene Symbol Kif7
Ensembl Gene ENSMUSG00000050382
Gene Namekinesin family member 7
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79698098-79715720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79713890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 90 (V90A)
Ref Sequence ENSEMBL: ENSMUSP00000139224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000035939
SMART Domains Protein: ENSMUSP00000039696
Gene: ENSMUSG00000039133

DomainStartEndE-ValueType
low complexity region 101 123 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000059836
AA Change: V90A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382
AA Change: V90A

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178048
AA Change: V90A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382
AA Change: V90A

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183846
AA Change: V90A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382
AA Change: V90A

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000184137
AA Change: V90A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382
AA Change: V90A

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197011
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cilia-associated protein belonging to the kinesin family. This protein plays a role in the sonic hedgehog (SHH) signaling pathway through the regulation of GLI transcription factors. It functions as a negative regulator of the SHH pathway by preventing inappropriate activation of GLI2 in the absence of ligand, and as a positive regulator by preventing the processing of GLI3 into its repressor form. Mutations in this gene have been associated with various ciliopathies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, exencephaly, polydactyly, abnormal sternum, edema, abnormal ribs, and abnormal neurogenesis. Mice homozygous for an ENU-induced allele exhibit prenatal lethality, polydactyly, and abnormal neural tube development and neurogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Kif7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:Kif7 APN 7 79702278 missense probably damaging 0.99
IGL01551:Kif7 APN 7 79710566 critical splice acceptor site probably null
IGL01897:Kif7 APN 7 79701052 missense probably damaging 0.97
IGL02541:Kif7 APN 7 79710880 missense possibly damaging 0.46
IGL02873:Kif7 APN 7 79706759 missense probably damaging 1.00
IGL03409:Kif7 APN 7 79707553 missense probably benign 0.04
PIT4131001:Kif7 UTSW 7 79711069 missense probably damaging 1.00
R0053:Kif7 UTSW 7 79702179 missense probably benign
R0243:Kif7 UTSW 7 79699560 missense possibly damaging 0.66
R0280:Kif7 UTSW 7 79698823 missense probably benign
R0492:Kif7 UTSW 7 79713881 missense probably damaging 1.00
R0563:Kif7 UTSW 7 79702272 missense probably benign 0.00
R1557:Kif7 UTSW 7 79714157 start codon destroyed probably null 0.01
R1637:Kif7 UTSW 7 79702837 missense probably damaging 1.00
R1889:Kif7 UTSW 7 79710463 missense probably damaging 1.00
R1934:Kif7 UTSW 7 79711538 missense probably benign 0.03
R1988:Kif7 UTSW 7 79699241 missense probably benign
R2259:Kif7 UTSW 7 79711589 missense probably damaging 1.00
R2418:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2419:Kif7 UTSW 7 79698693 missense probably benign 0.05
R2511:Kif7 UTSW 7 79702264 missense probably damaging 1.00
R2975:Kif7 UTSW 7 79710260 missense probably damaging 1.00
R3711:Kif7 UTSW 7 79710892 missense probably benign 0.40
R4258:Kif7 UTSW 7 79710513 nonsense probably null
R4543:Kif7 UTSW 7 79707548 missense probably benign 0.03
R4648:Kif7 UTSW 7 79709191 missense probably damaging 1.00
R5650:Kif7 UTSW 7 79710979 missense probably damaging 1.00
R5941:Kif7 UTSW 7 79711132 intron probably benign
R6025:Kif7 UTSW 7 79704640 missense probably benign 0.34
R6056:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
R6245:Kif7 UTSW 7 79702143 missense probably damaging 1.00
R6392:Kif7 UTSW 7 79702186 missense probably damaging 1.00
R6464:Kif7 UTSW 7 79714094 missense possibly damaging 0.63
X0063:Kif7 UTSW 7 79702278 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCTTGAGAAAGCCATTCACCC -3'
(R):5'- ATCAGAGTTGCCTGCGTGTG -3'

Sequencing Primer
(F):5'- ACCTGACATGGAGTGCTGAC -3'
(R):5'- CTGCGTGTGGAGCCTGAG -3'
Posted On2015-04-02