Incidental Mutation 'R3813:Adgrg1'
ID274152
Institutional Source Beutler Lab
Gene Symbol Adgrg1
Ensembl Gene ENSMUSG00000031785
Gene Nameadhesion G protein-coupled receptor G1
SynonymsCyt28, Gpr56
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94974751-95014217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 95011565 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 562 (L562Q)
Ref Sequence ENSEMBL: ENSMUSP00000148644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093271] [ENSMUST00000179619] [ENSMUST00000212660]
Predicted Effect probably benign
Transcript: ENSMUST00000093271
AA Change: L562Q

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090959
Gene: ENSMUSG00000031785
AA Change: L562Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 8.1e-32 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179619
AA Change: L562Q

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137520
Gene: ENSMUSG00000031785
AA Change: L562Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 3.4e-31 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211911
Predicted Effect probably benign
Transcript: ENSMUST00000212660
AA Change: L562Q

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit neuronal ectopias in the frontoparietal cortex due to disruptions in the pial basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Adgrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Adgrg1 APN 8 95005243 missense probably damaging 1.00
IGL01138:Adgrg1 APN 8 95003457 missense probably damaging 1.00
IGL01806:Adgrg1 APN 8 95012931 missense probably damaging 1.00
IGL02229:Adgrg1 APN 8 95003511 missense probably damaging 1.00
IGL03109:Adgrg1 APN 8 95007676 unclassified probably benign
D4043:Adgrg1 UTSW 8 95005229 unclassified probably null
R0383:Adgrg1 UTSW 8 95011742 missense probably damaging 1.00
R1155:Adgrg1 UTSW 8 95006840 missense possibly damaging 0.92
R1656:Adgrg1 UTSW 8 95011810 nonsense probably null
R1944:Adgrg1 UTSW 8 95007300 missense probably damaging 0.99
R1952:Adgrg1 UTSW 8 95008491 critical splice donor site probably null
R2408:Adgrg1 UTSW 8 95003493 missense probably null 1.00
R3776:Adgrg1 UTSW 8 95009655 missense probably damaging 0.99
R4254:Adgrg1 UTSW 8 95005902 unclassified probably null
R4255:Adgrg1 UTSW 8 95005902 unclassified probably null
R4951:Adgrg1 UTSW 8 95005246 missense probably damaging 1.00
R4997:Adgrg1 UTSW 8 95009520 missense probably damaging 1.00
R5152:Adgrg1 UTSW 8 95009745 missense probably damaging 1.00
R6122:Adgrg1 UTSW 8 95002501 missense probably benign 0.45
R6897:Adgrg1 UTSW 8 95002498 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGACTGGGTAACTGGATGC -3'
(R):5'- ATGACAAGCTGGAAGGTGCC -3'

Sequencing Primer
(F):5'- GTGTACATATCTGCATAGAGGCAC -3'
(R):5'- CTGGAAGGTGCCGGAAGC -3'
Posted On2015-04-02