Incidental Mutation 'R3813:Cenpj'
ID274165
Institutional Source Beutler Lab
Gene Symbol Cenpj
Ensembl Gene ENSMUSG00000064128
Gene Namecentromere protein J
Synonyms4932437H03Rik, Sas4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56526761-56575425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56553222 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 457 (S457P)
Ref Sequence ENSEMBL: ENSMUSP00000153013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065302] [ENSMUST00000225951]
Predicted Effect probably benign
Transcript: ENSMUST00000065302
AA Change: S457P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065949
Gene: ENSMUSG00000064128
AA Change: S457P

DomainStartEndE-ValueType
low complexity region 60 76 N/A INTRINSIC
coiled coil region 140 185 N/A INTRINSIC
low complexity region 330 350 N/A INTRINSIC
low complexity region 547 570 N/A INTRINSIC
low complexity region 860 871 N/A INTRINSIC
coiled coil region 899 1046 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Pfam:Tcp10_C 1167 1342 5.1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225951
AA Change: S457P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000229861
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the centromere protein family. During cell division, this protein plays a structural role in the maintenance of centrosome integrity and normal spindle morphology, and it is involved in microtubule disassembly at the centrosome. This protein can function as a transcriptional coactivator in the Stat5 signaling pathway, and also as a coactivator of NF-kappaB-mediated transcription, likely via its interaction with the coactivator p300/CREB-binding protein. Mutations in this gene are associated with primary autosomal recessive microcephaly, a disorder characterized by severely reduced brain size and mental retardation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for null alleles exhibit embryonic lethality during early organogenesis and may show failure of embryo turning and absence of centrioles, cilia and centrosomes. Mice homozygous for a hypomorphic allele display partial lethality, dwarfism and a wide range of abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Cenpj
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cenpj APN 14 56553030 missense probably benign 0.04
IGL00969:Cenpj APN 14 56564963 missense possibly damaging 0.68
IGL01152:Cenpj APN 14 56552300 missense probably benign 0.01
IGL01475:Cenpj APN 14 56565045 missense possibly damaging 0.80
IGL01548:Cenpj APN 14 56532319 missense probably benign 0.00
IGL01893:Cenpj APN 14 56553474 missense probably damaging 1.00
IGL02647:Cenpj APN 14 56530079 missense probably damaging 0.99
IGL02683:Cenpj APN 14 56552952 missense possibly damaging 0.88
IGL02691:Cenpj APN 14 56552090 missense probably benign 0.28
IGL03008:Cenpj APN 14 56526949 missense probably benign 0.39
R0206:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0208:Cenpj UTSW 14 56563970 missense probably benign 0.00
R0356:Cenpj UTSW 14 56549496 missense probably damaging 1.00
R0942:Cenpj UTSW 14 56555209 unclassified probably benign
R1392:Cenpj UTSW 14 56534854 splice site probably benign
R1564:Cenpj UTSW 14 56552066 missense probably benign 0.43
R1671:Cenpj UTSW 14 56565045 missense probably damaging 0.99
R1889:Cenpj UTSW 14 56558725 missense probably benign 0.43
R2059:Cenpj UTSW 14 56563955 missense possibly damaging 0.94
R2140:Cenpj UTSW 14 56526932 missense probably damaging 1.00
R2509:Cenpj UTSW 14 56532237 missense probably null 0.98
R2866:Cenpj UTSW 14 56552180 missense probably benign 0.01
R4620:Cenpj UTSW 14 56535454 missense probably damaging 0.99
R4670:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4671:Cenpj UTSW 14 56553383 missense possibly damaging 0.80
R4765:Cenpj UTSW 14 56549545 nonsense probably null
R4915:Cenpj UTSW 14 56553718 missense probably damaging 0.98
R4930:Cenpj UTSW 14 56534781 nonsense probably null
R5088:Cenpj UTSW 14 56553691 missense probably damaging 1.00
R5523:Cenpj UTSW 14 56552423 missense probably benign 0.00
R5527:Cenpj UTSW 14 56526983 missense probably damaging 1.00
R5717:Cenpj UTSW 14 56553521 frame shift probably null
R5944:Cenpj UTSW 14 56553658 critical splice donor site probably null
R5975:Cenpj UTSW 14 56564066 missense possibly damaging 0.92
R6019:Cenpj UTSW 14 56534815 missense probably benign 0.01
R6291:Cenpj UTSW 14 56551976 missense probably benign 0.01
R6948:Cenpj UTSW 14 56553226 missense probably damaging 0.96
R7212:Cenpj UTSW 14 56552652 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAACTGGTCCAGTGGAAAGAG -3'
(R):5'- AGCTAGCAAGTACGCAGAGC -3'

Sequencing Primer
(F):5'- GAGGAAGTCTCTCTCTCCCCTG -3'
(R):5'- GTACGCAGAGCCCATCAGAG -3'
Posted On2015-04-02