Incidental Mutation 'R3813:H2-Q4'
ID274174
Institutional Source Beutler Lab
Gene Symbol H2-Q4
Ensembl Gene ENSMUSG00000035929
Gene Namehistocompatibility 2, Q region locus 4
SynonymsH2-Gs10, Qa-4, Qb1, Qb-1, H-2Q4, Qa4, Qat-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R3813 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35379617-35385290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35383095 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 311 (H311R)
Ref Sequence ENSEMBL: ENSMUSP00000080159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081435
AA Change: H311R

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080159
Gene: ENSMUSG00000035929
AA Change: H311R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 50 228 1.7e-93 PFAM
IGc1 247 318 8.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173975
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: This locus controls an antigen on peripheral T-cells of spleen, lymph node and bone marrow, but not on thymocytes. Strain distribution patterns vary by assay, measuring presence/absence of antigen, protein acidic/basic qualities and molecular polymorphisms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Doc2g C T 19: 4,004,466 probably null Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in H2-Q4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:H2-Q4 APN 17 35382858 missense probably damaging 1.00
IGL01341:H2-Q4 APN 17 35383002 missense probably damaging 1.00
IGL01538:H2-Q4 APN 17 35383312 missense probably benign 0.03
IGL03258:H2-Q4 APN 17 35380119 missense probably benign 0.29
FR4304:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4340:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4342:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4589:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
LCD18:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
R1655:H2-Q4 UTSW 17 35382905 missense probably damaging 1.00
R1887:H2-Q4 UTSW 17 35380137 missense possibly damaging 0.94
R2013:H2-Q4 UTSW 17 35380550 missense probably damaging 1.00
R2073:H2-Q4 UTSW 17 35380402 missense possibly damaging 0.61
R2403:H2-Q4 UTSW 17 35379997 missense probably damaging 0.99
R3928:H2-Q4 UTSW 17 35379690 missense unknown
R5076:H2-Q4 UTSW 17 35380441 missense probably damaging 1.00
R5096:H2-Q4 UTSW 17 35379713 splice site probably benign
R5252:H2-Q4 UTSW 17 35380435 missense probably benign 0.00
R5318:H2-Q4 UTSW 17 35383311 missense possibly damaging 0.48
R5618:H2-Q4 UTSW 17 35379925 missense probably damaging 1.00
R6648:H2-Q4 UTSW 17 35383005 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCTGACGGTGATGTCAC -3'
(R):5'- GTTCGCCATGTTGGAGACAG -3'

Sequencing Primer
(F):5'- TGAGGTGCTGGGCCCTG -3'
(R):5'- CCATGTTGGAGACAGTGGATG -3'
Posted On2015-04-02