Incidental Mutation 'R3813:Doc2g'
ID274178
Institutional Source Beutler Lab
Gene Symbol Doc2g
Ensembl Gene ENSMUSG00000024871
Gene Namedouble C2, gamma
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R3813 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4003321-4007005 bp(+) (GRCm38)
Type of Mutationunclassified (2365 bp from exon)
DNA Base Change (assembly) C to T at 4004466 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025802] [ENSMUST00000025806] [ENSMUST00000041871] [ENSMUST00000042497] [ENSMUST00000122924] [ENSMUST00000128787] [ENSMUST00000129706] [ENSMUST00000133474] [ENSMUST00000134479] [ENSMUST00000136921] [ENSMUST00000155405]
Predicted Effect probably null
Transcript: ENSMUST00000025802
SMART Domains Protein: ENSMUSP00000025802
Gene: ENSMUSG00000110949

DomainStartEndE-ValueType
Pfam:NUDIX 26 160 2.8e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000025806
SMART Domains Protein: ENSMUSP00000025806
Gene: ENSMUSG00000024871

DomainStartEndE-ValueType
C2 99 206 1.14e-10 SMART
low complexity region 231 243 N/A INTRINSIC
C2 259 373 5.14e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000041871
SMART Domains Protein: ENSMUSP00000037401
Gene: ENSMUSG00000037477

DomainStartEndE-ValueType
TBOX 64 257 9.2e-117 SMART
low complexity region 309 320 N/A INTRINSIC
low complexity region 331 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042497
SMART Domains Protein: ENSMUSP00000042967
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 252 2.4e-52 PFAM
Pfam:SLBB 275 327 5.1e-10 PFAM
NADH_4Fe-4S 364 409 1.05e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000122924
SMART Domains Protein: ENSMUSP00000122531
Gene: ENSMUSG00000110949

DomainStartEndE-ValueType
Pfam:NUDIX 19 117 3.1e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127016
Predicted Effect probably benign
Transcript: ENSMUST00000128787
SMART Domains Protein: ENSMUSP00000123069
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 71 243 1.6e-52 PFAM
Pfam:SLBB 266 318 8.6e-10 PFAM
NADH_4Fe-4S 355 400 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129706
SMART Domains Protein: ENSMUSP00000115653
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 80 115 1.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132747
Predicted Effect probably benign
Transcript: ENSMUST00000133474
SMART Domains Protein: ENSMUSP00000120223
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 146 3.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134049
Predicted Effect probably benign
Transcript: ENSMUST00000134479
SMART Domains Protein: ENSMUSP00000121915
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 173 3.6e-53 PFAM
Pfam:SLBB 196 248 5.2e-11 PFAM
NADH_4Fe-4S 285 330 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136921
SMART Domains Protein: ENSMUSP00000123680
Gene: ENSMUSG00000037916

DomainStartEndE-ValueType
Pfam:Complex1_51K 1 114 6.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150852
Predicted Effect probably benign
Transcript: ENSMUST00000155405
SMART Domains Protein: ENSMUSP00000119218
Gene: ENSMUSG00000024869

DomainStartEndE-ValueType
Pfam:NUDIX 29 159 8.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156285
Meta Mutation Damage Score 0.6316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,488 R106S probably benign Het
Adamts3 T C 5: 89,677,926 D1018G possibly damaging Het
Adgrg1 T A 8: 95,011,565 L562Q probably benign Het
Ankrd11 T C 8: 122,891,378 T1891A probably benign Het
Arid2 A G 15: 96,369,950 N648S probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cacna1s A T 1: 136,085,347 I312F probably damaging Het
Cenpj A G 14: 56,553,222 S457P probably benign Het
Cep120 G A 18: 53,740,212 probably benign Het
Cfap70 T A 14: 20,421,122 I493L possibly damaging Het
Csmd3 T C 15: 48,791,813 D31G possibly damaging Het
Cstf3 T C 2: 104,609,121 Y54H probably damaging Het
Cubn T A 2: 13,294,325 Y3179F probably damaging Het
Cyp2s1 C T 7: 25,805,866 probably null Het
Dll4 C A 2: 119,331,029 T364N possibly damaging Het
Etl4 A G 2: 20,788,435 E657G probably damaging Het
Fhdc1 A G 3: 84,464,270 probably null Het
Fndc1 T C 17: 7,773,322 H514R unknown Het
Gpat3 A G 5: 100,891,639 probably benign Het
H2-Q4 A G 17: 35,383,095 H311R possibly damaging Het
Hipk4 T C 7: 27,523,947 L144S probably damaging Het
Hspa4 G A 11: 53,270,979 P449S probably benign Het
Kif7 A G 7: 79,713,890 V90A probably damaging Het
Klhl38 T C 15: 58,322,557 I259V probably benign Het
Krt9 T A 11: 100,189,677 E414D probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lrp2 G A 2: 69,464,579 P3465L probably damaging Het
Lrriq1 T C 10: 103,216,111 E260G probably damaging Het
Macf1 A G 4: 123,374,767 S4689P probably damaging Het
Manba G A 3: 135,563,262 E643K possibly damaging Het
Mc3r T A 2: 172,248,879 L7Q probably benign Het
Mdga1 G A 17: 29,838,479 P788S probably damaging Het
Olfr1161 T C 2: 88,024,761 F13S probably damaging Het
Olfr814 T A 10: 129,873,986 Y257F probably damaging Het
Pcdh12 G A 18: 38,283,614 R153* probably null Het
Plk3 T C 4: 117,133,450 Y89C probably damaging Het
Prss41 G A 17: 23,837,622 R160* probably null Het
Rae1 T A 2: 173,006,873 probably benign Het
Rbm17 T A 2: 11,595,435 probably benign Het
Recql4 A T 15: 76,704,494 M1039K possibly damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slit3 A G 11: 35,675,979 Y1026C probably damaging Het
Tbl2 T A 5: 135,156,521 probably null Het
Tex2 G A 11: 106,511,944 T1034I unknown Het
Tmem241 A T 18: 12,067,110 probably benign Het
Tmtc1 T C 6: 148,354,891 probably benign Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Trmt1 T A 8: 84,695,217 probably benign Het
Vps37d G A 5: 135,074,450 Q113* probably null Het
Zufsp T C 10: 33,940,222 E242G possibly damaging Het
Other mutations in Doc2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Doc2g APN 19 4006577 missense probably damaging 1.00
IGL02952:Doc2g APN 19 4006719 missense possibly damaging 0.83
PIT4585001:Doc2g UTSW 19 4006630 missense probably benign 0.41
R0194:Doc2g UTSW 19 4003656 missense probably benign 0.00
R4508:Doc2g UTSW 19 4004036 splice site probably benign
R7023:Doc2g UTSW 19 4004778 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAAGAGTCAGGGTAGCAG -3'
(R):5'- CCCAGCTTGAACTTCAGTCC -3'

Sequencing Primer
(F):5'- TCAGGGTAGCAGGCCAG -3'
(R):5'- AGCTTCCGCTTCTCTAGACAGATG -3'
Posted On2015-04-02