Incidental Mutation 'R3815:Luc7l2'
ID274233
Institutional Source Beutler Lab
Gene Symbol Luc7l2
Ensembl Gene ENSMUSG00000029823
Gene NameLUC7-like 2 (S. cerevisiae)
Synonyms4930471C18Rik, CGI-59, CGI-74
MMRRC Submission 040770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R3815 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38551334-38609470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38570591 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 69 (S69P)
Ref Sequence ENSEMBL: ENSMUSP00000125573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057692] [ENSMUST00000159936] [ENSMUST00000160511] [ENSMUST00000161227] [ENSMUST00000161538] [ENSMUST00000162386] [ENSMUST00000163047]
Predicted Effect probably benign
Transcript: ENSMUST00000057692
AA Change: V48A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000055254
Gene: ENSMUSG00000029823
AA Change: V48A

DomainStartEndE-ValueType
Pfam:LUC7 5 257 6.5e-84 PFAM
low complexity region 269 341 N/A INTRINSIC
low complexity region 347 370 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159936
AA Change: S69P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160430
SMART Domains Protein: ENSMUSP00000124686
Gene: ENSMUSG00000029823

DomainStartEndE-ValueType
Pfam:LUC7 1 211 9.9e-70 PFAM
low complexity region 217 281 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160511
AA Change: S69P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160582
Predicted Effect probably benign
Transcript: ENSMUST00000161227
SMART Domains Protein: ENSMUSP00000125111
Gene: ENSMUSG00000029823

DomainStartEndE-ValueType
Pfam:LUC7 1 288 6.9e-65 PFAM
low complexity region 294 317 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161538
AA Change: V48A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124010
Gene: ENSMUSG00000029823
AA Change: V48A

DomainStartEndE-ValueType
Pfam:LUC7 4 309 3.3e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000162386
AA Change: S69P

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162530
Predicted Effect probably benign
Transcript: ENSMUST00000163047
SMART Domains Protein: ENSMUSP00000125394
Gene: ENSMUSG00000029823

DomainStartEndE-ValueType
Pfam:LUC7 1 257 3.2e-66 PFAM
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a C2H2-type zinc finger, coiled-coil region and arginine, serine-rich (RS) domain. A similar protein in mouse interacts with sodium channel modifier 1, and the encoded protein may be involved in the recognition of non-consensus splice donor sites in association with the U1 snRNP spliceosomal subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A G 13: 68,611,225 H106R probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Aldh18a1 A G 19: 40,570,500 S299P probably damaging Het
Als2cr12 T G 1: 58,659,005 N379T probably damaging Het
Ankrd6 A C 4: 32,806,206 S618R probably benign Het
Apobec3 G T 15: 79,899,100 R126M possibly damaging Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
AW554918 C T 18: 25,400,047 R253C probably benign Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Cdca7l G A 12: 117,872,213 V95I probably damaging Het
Ces1e A G 8: 93,201,839 probably null Het
Coq5 T G 5: 115,295,898 F306V probably damaging Het
Cpsf1 A G 15: 76,601,149 V501A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cul5 T A 9: 53,622,943 I630L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dedd A G 1: 171,338,901 E135G probably benign Het
Ecel1 A G 1: 87,152,900 F368S probably damaging Het
Ext1 A C 15: 53,345,089 I92S probably benign Het
Fbxw5 A T 2: 25,503,564 D268V possibly damaging Het
Gen1 A T 12: 11,252,033 V192E possibly damaging Het
Gm11077 T G 6: 140,729,315 V11G unknown Het
Ift88 A T 14: 57,440,981 E150V possibly damaging Het
Kcna1 T C 6: 126,643,046 R104G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt82 A G 15: 101,550,600 S2P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Mamstr G T 7: 45,644,532 R20L probably damaging Het
Nav1 C A 1: 135,471,124 K573N possibly damaging Het
Olfr1457 T C 19: 13,094,913 H245R probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Palld T A 8: 61,549,837 probably benign Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp1r9b A T 11: 94,992,533 E329V probably damaging Het
Rarres1 T A 3: 67,515,321 D32V probably benign Het
Rhobtb1 A G 10: 69,285,693 H53R possibly damaging Het
Ryr1 A T 7: 29,072,902 S2494T probably damaging Het
Sapcd2 G A 2: 25,373,506 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp1 A C 15: 98,056,832 D490E probably damaging Het
Sfrp5 C T 19: 42,198,791 R280H probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Skint5 G A 4: 113,846,299 T499I possibly damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Spire1 G T 18: 67,506,663 T273K probably benign Het
Tep1 T C 14: 50,868,315 T83A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttn T A 2: 76,721,733 R29441* probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Luc7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Luc7l2 APN 6 38608170 unclassified probably benign
IGL00684:Luc7l2 APN 6 38608176 unclassified probably benign
IGL00785:Luc7l2 APN 6 38598786 missense possibly damaging 0.73
R0004:Luc7l2 UTSW 6 38589234 missense probably damaging 1.00
R0304:Luc7l2 UTSW 6 38592776 missense probably damaging 0.98
R1820:Luc7l2 UTSW 6 38598819 splice site probably null
R2223:Luc7l2 UTSW 6 38565724 intron probably benign
R5016:Luc7l2 UTSW 6 38585101 missense possibly damaging 0.54
Z1088:Luc7l2 UTSW 6 38603369 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGTACATAGACTGCAACTG -3'
(R):5'- TGACCCTGTGAGAACATGCC -3'

Sequencing Primer
(F):5'- GCAACTGCATGCTGTCTAAAATAG -3'
(R):5'- TGTGAGAACATGCCCCTGG -3'
Posted On2015-04-02