Incidental Mutation 'R3815:Palld'
ID274243
Institutional Source Beutler Lab
Gene Symbol Palld
Ensembl Gene ENSMUSG00000058056
Gene Namepalladin, cytoskeletal associated protein
Synonyms2410003B16Rik
MMRRC Submission 040770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3815 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location61511433-61902690 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 61549837 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]
Predicted Effect probably benign
Transcript: ENSMUST00000034057
SMART Domains Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 667 N/A INTRINSIC
IGc2 796 865 3.1e-9 SMART
low complexity region 881 906 N/A INTRINSIC
IGc2 930 998 4.92e-12 SMART
IGc2 1029 1098 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121200
AA Change: E70D
SMART Domains Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: E70D

DomainStartEndE-ValueType
low complexity region 37 68 N/A INTRINSIC
low complexity region 77 112 N/A INTRINSIC
IGc2 293 362 3.1e-9 SMART
low complexity region 378 403 N/A INTRINSIC
IGc2 427 495 4.92e-12 SMART
IGc2 526 595 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121493
AA Change: E409D
SMART Domains Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: E409D

DomainStartEndE-ValueType
IGc2 71 146 1.6e-11 SMART
low complexity region 250 284 N/A INTRINSIC
low complexity region 298 326 N/A INTRINSIC
low complexity region 376 407 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
IGc2 632 701 3.1e-9 SMART
low complexity region 717 742 N/A INTRINSIC
IGc2 766 834 4.92e-12 SMART
IGc2 865 934 1.61e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000121785
AA Change: E798D
SMART Domains Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: E798D

DomainStartEndE-ValueType
IGc2 290 358 1.45e-9 SMART
low complexity region 372 385 N/A INTRINSIC
IGc2 460 535 1.6e-11 SMART
low complexity region 639 673 N/A INTRINSIC
low complexity region 687 715 N/A INTRINSIC
low complexity region 765 796 N/A INTRINSIC
low complexity region 805 840 N/A INTRINSIC
IGc2 1038 1107 3.1e-9 SMART
low complexity region 1123 1148 N/A INTRINSIC
IGc2 1172 1240 4.92e-12 SMART
IGc2 1271 1340 1.61e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135439
SMART Domains Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056

DomainStartEndE-ValueType
IGc2 82 151 3.1e-9 SMART
low complexity region 167 192 N/A INTRINSIC
IGc2 216 284 4.92e-12 SMART
internal_repeat_1 302 336 1.47e-9 PROSPERO
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A G 13: 68,611,225 H106R probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Aldh18a1 A G 19: 40,570,500 S299P probably damaging Het
Als2cr12 T G 1: 58,659,005 N379T probably damaging Het
Ankrd6 A C 4: 32,806,206 S618R probably benign Het
Apobec3 G T 15: 79,899,100 R126M possibly damaging Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
AW554918 C T 18: 25,400,047 R253C probably benign Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Cdca7l G A 12: 117,872,213 V95I probably damaging Het
Ces1e A G 8: 93,201,839 probably null Het
Coq5 T G 5: 115,295,898 F306V probably damaging Het
Cpsf1 A G 15: 76,601,149 V501A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cul5 T A 9: 53,622,943 I630L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dedd A G 1: 171,338,901 E135G probably benign Het
Ecel1 A G 1: 87,152,900 F368S probably damaging Het
Ext1 A C 15: 53,345,089 I92S probably benign Het
Fbxw5 A T 2: 25,503,564 D268V possibly damaging Het
Gen1 A T 12: 11,252,033 V192E possibly damaging Het
Gm11077 T G 6: 140,729,315 V11G unknown Het
Ift88 A T 14: 57,440,981 E150V possibly damaging Het
Kcna1 T C 6: 126,643,046 R104G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt82 A G 15: 101,550,600 S2P probably damaging Het
Luc7l2 T C 6: 38,570,591 S69P possibly damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Mamstr G T 7: 45,644,532 R20L probably damaging Het
Nav1 C A 1: 135,471,124 K573N possibly damaging Het
Olfr1457 T C 19: 13,094,913 H245R probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp1r9b A T 11: 94,992,533 E329V probably damaging Het
Rarres1 T A 3: 67,515,321 D32V probably benign Het
Rhobtb1 A G 10: 69,285,693 H53R possibly damaging Het
Ryr1 A T 7: 29,072,902 S2494T probably damaging Het
Sapcd2 G A 2: 25,373,506 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp1 A C 15: 98,056,832 D490E probably damaging Het
Sfrp5 C T 19: 42,198,791 R280H probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Skint5 G A 4: 113,846,299 T499I possibly damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Spire1 G T 18: 67,506,663 T273K probably benign Het
Tep1 T C 14: 50,868,315 T83A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttn T A 2: 76,721,733 R29441* probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Palld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Palld APN 8 61515935 missense possibly damaging 0.77
IGL01083:Palld APN 8 61538807 missense probably benign 0.44
IGL01644:Palld APN 8 61877478 missense probably benign 0.28
IGL01672:Palld APN 8 61877502 missense probably benign 0.22
IGL01941:Palld APN 8 61535700 missense probably benign 0.44
IGL02037:Palld APN 8 61525114 missense probably damaging 1.00
IGL02126:Palld APN 8 61877442 missense possibly damaging 0.82
IGL02537:Palld APN 8 61684934 missense probably benign 0.05
IGL02632:Palld APN 8 61515245 missense probably damaging 1.00
IGL02809:Palld APN 8 61515247 missense probably damaging 1.00
IGL02901:Palld APN 8 61876995 nonsense probably null
IGL03400:Palld APN 8 61513455 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0098:Palld UTSW 8 61525086 missense probably damaging 1.00
R0745:Palld UTSW 8 61877703 missense probably damaging 1.00
R1263:Palld UTSW 8 61513457 frame shift probably null
R1342:Palld UTSW 8 61522882 critical splice donor site probably null
R1893:Palld UTSW 8 61516621 missense probably damaging 1.00
R2017:Palld UTSW 8 61684765 missense probably damaging 0.99
R2102:Palld UTSW 8 61533433 missense possibly damaging 0.82
R2129:Palld UTSW 8 61877361 missense probably benign 0.00
R2246:Palld UTSW 8 61877135 missense probably benign 0.01
R3545:Palld UTSW 8 61550078 missense possibly damaging 0.95
R3824:Palld UTSW 8 61709033 missense probably damaging 1.00
R4412:Palld UTSW 8 61687372 missense probably damaging 0.98
R4781:Palld UTSW 8 61877028 missense probably benign 0.01
R4836:Palld UTSW 8 61687381 missense probably benign 0.11
R4871:Palld UTSW 8 61549781 intron probably benign
R4963:Palld UTSW 8 61703210 missense probably damaging 1.00
R5036:Palld UTSW 8 61550162 missense probably damaging 1.00
R5128:Palld UTSW 8 61720588 missense probably damaging 1.00
R5343:Palld UTSW 8 61549815 intron probably benign
R5421:Palld UTSW 8 61516550 missense probably damaging 1.00
R5427:Palld UTSW 8 61550072 missense probably benign 0.01
R5561:Palld UTSW 8 61516585 missense probably damaging 1.00
R5651:Palld UTSW 8 61538788 missense probably damaging 1.00
R5679:Palld UTSW 8 61684945 missense possibly damaging 0.95
R5915:Palld UTSW 8 61533352 critical splice donor site probably null
R6153:Palld UTSW 8 61550152 missense probably damaging 1.00
R6276:Palld UTSW 8 61513423 missense probably damaging 1.00
R6323:Palld UTSW 8 61720693 missense probably damaging 1.00
R6659:Palld UTSW 8 61533443 missense probably benign 0.28
R7016:Palld UTSW 8 61515998 missense probably damaging 1.00
R7124:Palld UTSW 8 61516645 missense unknown
R7145:Palld UTSW 8 61532017 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGGAGATGCTAAGTGTCAC -3'
(R):5'- AGCAGCTGCAGAACCAAGTG -3'

Sequencing Primer
(F):5'- AGGGCGTTGACAGCGAC -3'
(R):5'- TGTCCCTTGCAACAGCAG -3'
Posted On2015-04-02