Incidental Mutation 'R3815:Sorl1'
ID 274249
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
MMRRC Submission 040770-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.315) question?
Stock # R3815 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 41975345 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 487 (L487P)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: L487P

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: L487P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.3653 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T C 6: 86,936,024 (GRCm39) probably benign Het
Aldh18a1 A G 19: 40,558,944 (GRCm39) S299P probably damaging Het
Ankrd6 A C 4: 32,806,206 (GRCm39) S618R probably benign Het
Apobec3 G T 15: 79,783,301 (GRCm39) R126M possibly damaging Het
Arl8b T A 6: 108,790,658 (GRCm39) V65D probably damaging Het
AW554918 C T 18: 25,533,104 (GRCm39) R253C probably benign Het
Cd177 A G 7: 24,453,817 (GRCm39) V358A probably benign Het
Cdca7l G A 12: 117,835,948 (GRCm39) V95I probably damaging Het
Ces1e A G 8: 93,928,467 (GRCm39) probably null Het
Cfap90 A G 13: 68,759,344 (GRCm39) H106R probably damaging Het
Coq5 T G 5: 115,433,957 (GRCm39) F306V probably damaging Het
Cpsf1 A G 15: 76,485,349 (GRCm39) V501A probably benign Het
Csmd1 C T 8: 16,052,522 (GRCm39) A2201T probably damaging Het
Cul5 T A 9: 53,534,243 (GRCm39) I630L probably benign Het
Cyp4a12b A T 4: 115,289,667 (GRCm39) D178V probably damaging Het
Dedd A G 1: 171,166,469 (GRCm39) E135G probably benign Het
Ecel1 A G 1: 87,080,622 (GRCm39) F368S probably damaging Het
Ext1 A C 15: 53,208,485 (GRCm39) I92S probably benign Het
Fbxw5 A T 2: 25,393,576 (GRCm39) D268V possibly damaging Het
Flacc1 T G 1: 58,698,164 (GRCm39) N379T probably damaging Het
Gen1 A T 12: 11,302,034 (GRCm39) V192E possibly damaging Het
Gm11077 T G 6: 140,675,041 (GRCm39) V11G unknown Het
Ift88 A T 14: 57,678,438 (GRCm39) E150V possibly damaging Het
Kcna1 T C 6: 126,620,009 (GRCm39) R104G probably damaging Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Krt82 A G 15: 101,459,035 (GRCm39) S2P probably damaging Het
Luc7l2 T C 6: 38,547,526 (GRCm39) S69P possibly damaging Het
Ly9 G T 1: 171,416,653 (GRCm39) T537N possibly damaging Het
Mamstr G T 7: 45,293,956 (GRCm39) R20L probably damaging Het
Nav1 C A 1: 135,398,862 (GRCm39) K573N possibly damaging Het
Or5b104 T C 19: 13,072,277 (GRCm39) H245R probably damaging Het
Or8b12c C T 9: 37,715,465 (GRCm39) S86L probably benign Het
Or8b40 A T 9: 38,027,922 (GRCm39) T277S possibly damaging Het
Or8b55 A G 9: 38,727,722 (GRCm39) K308E possibly damaging Het
Palld T A 8: 62,002,871 (GRCm39) probably benign Het
Pcdha2 A G 18: 37,074,748 (GRCm39) Y793C probably benign Het
Pcdhb4 A T 18: 37,441,065 (GRCm39) D125V probably damaging Het
Pomgnt1 T A 4: 116,011,139 (GRCm39) probably null Het
Ppp1r9b A T 11: 94,883,359 (GRCm39) E329V probably damaging Het
Rarres1 T A 3: 67,422,654 (GRCm39) D32V probably benign Het
Rhobtb1 A G 10: 69,121,523 (GRCm39) H53R possibly damaging Het
Ryr1 A T 7: 28,772,327 (GRCm39) S2494T probably damaging Het
Sapcd2 G A 2: 25,263,518 (GRCm39) probably benign Het
Secisbp2l C T 2: 125,582,657 (GRCm39) G933D possibly damaging Het
Senp1 A C 15: 97,954,713 (GRCm39) D490E probably damaging Het
Sfrp5 C T 19: 42,187,230 (GRCm39) R280H probably benign Het
Skint5 A G 4: 113,486,319 (GRCm39) probably benign Het
Skint5 G A 4: 113,703,496 (GRCm39) T499I possibly damaging Het
Smad1 G A 8: 80,070,359 (GRCm39) A393V probably benign Het
Spire1 G T 18: 67,639,733 (GRCm39) T273K probably benign Het
Tep1 T C 14: 51,105,772 (GRCm39) T83A possibly damaging Het
Top2b T G 14: 16,409,189 (GRCm38) I777M probably damaging Het
Ttn T A 2: 76,552,077 (GRCm39) R29441* probably null Het
Wdr37 A G 13: 8,903,632 (GRCm39) probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R0924:Sorl1 UTSW 9 41,919,470 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1912:Sorl1 UTSW 9 41,993,246 (GRCm39) missense probably damaging 1.00
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5385:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6702:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGACATCCCAGCTAGTAGC -3'
(R):5'- TCTAAGTCTGGATTCCTCTGGG -3'

Sequencing Primer
(F):5'- GTCACTAGGATAATGTCGTAAAGCC -3'
(R):5'- TGGATTCCTCTGGGCCAGAC -3'
Posted On 2015-04-02