Incidental Mutation 'R3815:Ift88'
ID274263
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Nameintraflagellar transport 88
SynonymsTg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
MMRRC Submission 040770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3815 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57424062-57517936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57440981 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 150 (E150V)
Ref Sequence ENSEMBL: ENSMUSP00000113768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063] [ENSMUST00000150296]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119952
Predicted Effect possibly damaging
Transcript: ENSMUST00000122063
AA Change: E150V

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040
AA Change: E150V

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154492
Predicted Effect probably benign
Transcript: ENSMUST00000171682
SMART Domains Protein: ENSMUSP00000130475
Gene: ENSMUSG00000040040

DomainStartEndE-ValueType
Pfam:DUF3808 1 164 2.7e-8 PFAM
Pfam:TPR_11 3 76 8.7e-11 PFAM
Pfam:TPR_12 3 77 3.8e-11 PFAM
Pfam:TPR_8 6 37 7e-4 PFAM
Pfam:TPR_2 7 38 1.8e-6 PFAM
Pfam:TPR_1 7 39 3.4e-9 PFAM
Pfam:TPR_7 8 41 1.9e-7 PFAM
Pfam:TPR_8 45 78 2.2e-3 PFAM
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A G 13: 68,611,225 H106R probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Aldh18a1 A G 19: 40,570,500 S299P probably damaging Het
Als2cr12 T G 1: 58,659,005 N379T probably damaging Het
Ankrd6 A C 4: 32,806,206 S618R probably benign Het
Apobec3 G T 15: 79,899,100 R126M possibly damaging Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
AW554918 C T 18: 25,400,047 R253C probably benign Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Cdca7l G A 12: 117,872,213 V95I probably damaging Het
Ces1e A G 8: 93,201,839 probably null Het
Coq5 T G 5: 115,295,898 F306V probably damaging Het
Cpsf1 A G 15: 76,601,149 V501A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cul5 T A 9: 53,622,943 I630L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dedd A G 1: 171,338,901 E135G probably benign Het
Ecel1 A G 1: 87,152,900 F368S probably damaging Het
Ext1 A C 15: 53,345,089 I92S probably benign Het
Fbxw5 A T 2: 25,503,564 D268V possibly damaging Het
Gen1 A T 12: 11,252,033 V192E possibly damaging Het
Gm11077 T G 6: 140,729,315 V11G unknown Het
Kcna1 T C 6: 126,643,046 R104G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt82 A G 15: 101,550,600 S2P probably damaging Het
Luc7l2 T C 6: 38,570,591 S69P possibly damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Mamstr G T 7: 45,644,532 R20L probably damaging Het
Nav1 C A 1: 135,471,124 K573N possibly damaging Het
Olfr1457 T C 19: 13,094,913 H245R probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Palld T A 8: 61,549,837 probably benign Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp1r9b A T 11: 94,992,533 E329V probably damaging Het
Rarres1 T A 3: 67,515,321 D32V probably benign Het
Rhobtb1 A G 10: 69,285,693 H53R possibly damaging Het
Ryr1 A T 7: 29,072,902 S2494T probably damaging Het
Sapcd2 G A 2: 25,373,506 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp1 A C 15: 98,056,832 D490E probably damaging Het
Sfrp5 C T 19: 42,198,791 R280H probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Skint5 G A 4: 113,846,299 T499I possibly damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Spire1 G T 18: 67,506,663 T273K probably benign Het
Tep1 T C 14: 50,868,315 T83A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttn T A 2: 76,721,733 R29441* probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0392:Ift88 UTSW 14 57496160 splice site probably benign
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4704:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6602:Ift88 UTSW 14 57507259 missense probably benign 0.00
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7241:Ift88 UTSW 14 57479997 missense probably damaging 0.97
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTGATGCAGCTGTGATGG -3'
(R):5'- CAATTGTGGTATAAGAGTTTGTAAGGC -3'

Sequencing Primer
(F):5'- GTGATCTCGGCAGAACTTTCTAAGC -3'
(R):5'- AAGTAGATACAGACATCTGC -3'
Posted On2015-04-02