Incidental Mutation 'R3815:Cpsf1'
ID274265
Institutional Source Beutler Lab
Gene Symbol Cpsf1
Ensembl Gene ENSMUSG00000034022
Gene Namecleavage and polyadenylation specific factor 1
Synonyms
MMRRC Submission 040770-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R3815 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76595803-76607591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76601149 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 501 (V501A)
Ref Sequence ENSEMBL: ENSMUSP00000155308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071898] [ENSMUST00000230157] [ENSMUST00000231042]
Predicted Effect probably benign
Transcript: ENSMUST00000071898
AA Change: V501A

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071794
Gene: ENSMUSG00000034022
AA Change: V501A

DomainStartEndE-ValueType
Pfam:MMS1_N 92 684 7.2e-42 PFAM
low complexity region 902 910 N/A INTRINSIC
Pfam:CPSF_A 1071 1407 4.9e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229269
Predicted Effect probably benign
Transcript: ENSMUST00000229287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229437
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230149
Predicted Effect probably benign
Transcript: ENSMUST00000230157
AA Change: V501A

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231037
Predicted Effect probably benign
Transcript: ENSMUST00000231042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231191
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cleavage and polyadenylation specificity factor (CPSF) is a multisubunit complex that plays a central role in 3-prime processing of pre-mRNAs. CPSF recognizes the AAUAAA signal in the pre-mRNA and interacts with other proteins to facilitate both RNA cleavage and poly(A) synthesis. CPSF1 is the largest subunit of the CPSF complex (Murthy and Manley, 1995 [PubMed 7590244]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001L19Rik A G 13: 68,611,225 H106R probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Aldh18a1 A G 19: 40,570,500 S299P probably damaging Het
Als2cr12 T G 1: 58,659,005 N379T probably damaging Het
Ankrd6 A C 4: 32,806,206 S618R probably benign Het
Apobec3 G T 15: 79,899,100 R126M possibly damaging Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
AW554918 C T 18: 25,400,047 R253C probably benign Het
Cd177 A G 7: 24,754,392 V358A probably benign Het
Cdca7l G A 12: 117,872,213 V95I probably damaging Het
Ces1e A G 8: 93,201,839 probably null Het
Coq5 T G 5: 115,295,898 F306V probably damaging Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cul5 T A 9: 53,622,943 I630L probably benign Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dedd A G 1: 171,338,901 E135G probably benign Het
Ecel1 A G 1: 87,152,900 F368S probably damaging Het
Ext1 A C 15: 53,345,089 I92S probably benign Het
Fbxw5 A T 2: 25,503,564 D268V possibly damaging Het
Gen1 A T 12: 11,252,033 V192E possibly damaging Het
Gm11077 T G 6: 140,729,315 V11G unknown Het
Ift88 A T 14: 57,440,981 E150V possibly damaging Het
Kcna1 T C 6: 126,643,046 R104G probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt82 A G 15: 101,550,600 S2P probably damaging Het
Luc7l2 T C 6: 38,570,591 S69P possibly damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Mamstr G T 7: 45,644,532 R20L probably damaging Het
Nav1 C A 1: 135,471,124 K573N possibly damaging Het
Olfr1457 T C 19: 13,094,913 H245R probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Palld T A 8: 61,549,837 probably benign Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Ppp1r9b A T 11: 94,992,533 E329V probably damaging Het
Rarres1 T A 3: 67,515,321 D32V probably benign Het
Rhobtb1 A G 10: 69,285,693 H53R possibly damaging Het
Ryr1 A T 7: 29,072,902 S2494T probably damaging Het
Sapcd2 G A 2: 25,373,506 probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Senp1 A C 15: 98,056,832 D490E probably damaging Het
Sfrp5 C T 19: 42,198,791 R280H probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Skint5 G A 4: 113,846,299 T499I possibly damaging Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Spire1 G T 18: 67,506,663 T273K probably benign Het
Tep1 T C 14: 50,868,315 T83A possibly damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Ttn T A 2: 76,721,733 R29441* probably null Het
Wdr37 A G 13: 8,853,596 probably benign Het
Other mutations in Cpsf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cpsf1 APN 15 76600216 missense probably benign 0.27
IGL01013:Cpsf1 APN 15 76599297 nonsense probably null
IGL01599:Cpsf1 APN 15 76596541 missense probably damaging 1.00
IGL02008:Cpsf1 APN 15 76603091 missense probably damaging 1.00
IGL02291:Cpsf1 APN 15 76602821 missense probably damaging 1.00
IGL02901:Cpsf1 APN 15 76599496 nonsense probably null
IGL02929:Cpsf1 APN 15 76602127 critical splice donor site probably null
IGL03402:Cpsf1 APN 15 76596003 splice site probably null
R0005:Cpsf1 UTSW 15 76600680 critical splice donor site probably null
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0044:Cpsf1 UTSW 15 76599553 missense probably benign
R0487:Cpsf1 UTSW 15 76597002 missense probably damaging 1.00
R0510:Cpsf1 UTSW 15 76603657 intron probably benign
R0630:Cpsf1 UTSW 15 76601971 missense probably damaging 1.00
R0780:Cpsf1 UTSW 15 76600377 missense probably benign 0.17
R1617:Cpsf1 UTSW 15 76602370 nonsense probably null
R1717:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
R1889:Cpsf1 UTSW 15 76602156 missense probably benign 0.06
R1994:Cpsf1 UTSW 15 76603160 missense probably benign 0.03
R2168:Cpsf1 UTSW 15 76603737 missense possibly damaging 0.69
R2359:Cpsf1 UTSW 15 76597673 missense probably benign 0.02
R2697:Cpsf1 UTSW 15 76599329 missense probably damaging 1.00
R2847:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R2848:Cpsf1 UTSW 15 76602851 missense probably damaging 1.00
R3409:Cpsf1 UTSW 15 76601781 nonsense probably null
R3410:Cpsf1 UTSW 15 76601781 nonsense probably null
R4030:Cpsf1 UTSW 15 76601779 missense possibly damaging 0.96
R4491:Cpsf1 UTSW 15 76597722 missense possibly damaging 0.85
R4615:Cpsf1 UTSW 15 76596937 missense possibly damaging 0.88
R5227:Cpsf1 UTSW 15 76598948 missense probably damaging 1.00
R5353:Cpsf1 UTSW 15 76602571 missense probably damaging 1.00
R5548:Cpsf1 UTSW 15 76597327 missense possibly damaging 0.95
R5552:Cpsf1 UTSW 15 76599646 missense probably benign 0.27
R5746:Cpsf1 UTSW 15 76599837 missense probably benign 0.01
R6319:Cpsf1 UTSW 15 76596967 missense probably damaging 1.00
R6360:Cpsf1 UTSW 15 76597455 frame shift probably null
R6572:Cpsf1 UTSW 15 76597455 frame shift probably null
R6574:Cpsf1 UTSW 15 76597455 frame shift probably null
R6576:Cpsf1 UTSW 15 76597455 frame shift probably null
R6577:Cpsf1 UTSW 15 76597455 frame shift probably null
R6588:Cpsf1 UTSW 15 76596822 missense probably damaging 1.00
R6595:Cpsf1 UTSW 15 76602510 missense probably damaging 1.00
R6621:Cpsf1 UTSW 15 76603519 missense probably damaging 1.00
R6880:Cpsf1 UTSW 15 76602539 missense probably benign 0.06
R6954:Cpsf1 UTSW 15 76599496 missense probably damaging 1.00
R7100:Cpsf1 UTSW 15 76596114 missense possibly damaging 0.73
R7255:Cpsf1 UTSW 15 76597543 missense probably damaging 1.00
R7318:Cpsf1 UTSW 15 76597275 nonsense probably null
R7371:Cpsf1 UTSW 15 76600575 missense probably damaging 1.00
R7387:Cpsf1 UTSW 15 76602566 missense possibly damaging 0.77
X0052:Cpsf1 UTSW 15 76596302 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTCCACATATCATAGCAGCCAG -3'
(R):5'- CCTACCTGACCATTGCTGTG -3'

Sequencing Primer
(F):5'- CCAGGAAGTTCAAAGGTTGTCACC -3'
(R):5'- TGTGACAGCATGCTCAACATTGG -3'
Posted On2015-04-02