Incidental Mutation 'R3816:Skint5'
ID274292
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
MMRRC Submission 040881-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R3816 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 113629122 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105]
Predicted Effect probably benign
Transcript: ENSMUST00000169631
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170105
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Meta Mutation Damage Score 0.1628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,830,494 I12N probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Abca2 A G 2: 25,446,071 Y2151C probably damaging Het
Adamts3 T A 5: 89,705,264 H509L probably damaging Het
Agfg2 T C 5: 137,653,774 D441G probably benign Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
As3mt A T 19: 46,707,777 D8V probably benign Het
Ass1 G T 2: 31,510,105 probably benign Het
Cdc42bpa A G 1: 180,144,886 I634V possibly damaging Het
Cflar T C 1: 58,752,423 V298A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dlec1 C T 9: 119,124,843 A610V probably damaging Het
Dock1 C T 7: 134,744,286 R186* probably null Het
E130018O15Rik T C 5: 35,382,766 noncoding transcript Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gipc2 T C 3: 152,165,844 K15R probably benign Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Glipr2 G T 4: 43,977,522 A51S possibly damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
H2-M10.2 A T 17: 36,286,362 Y20* probably null Het
Hlcs A G 16: 94,133,088 V242A probably benign Het
Ifi44 T C 3: 151,749,257 I110M possibly damaging Het
Il18r1 T C 1: 40,486,972 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Khk T C 5: 30,926,716 S80P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo1g A G 11: 6,510,926 V706A probably benign Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr700 A G 7: 106,805,820 I214T probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pdgfrb A G 18: 61,078,945 D844G probably damaging Het
Phf3 T C 1: 30,805,753 D1375G probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rac2 T C 15: 78,565,999 D47G possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall1 G T 8: 89,032,675 A267E probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpina3k A G 12: 104,340,962 E151G probably benign Het
Slc51b A G 9: 65,414,018 probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Star G A 8: 25,809,877 M82I probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Usp32 A G 11: 84,994,384 probably null Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vwa3a A G 7: 120,800,379 T1028A probably benign Het
Xrn2 G A 2: 147,028,200 G270R probably damaging Het
Zbbx G T 3: 75,085,495 Q231K probably benign Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2406:Skint5 UTSW 4 113942667 missense probably damaging 0.97
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5070:Skint5 UTSW 4 113795538 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6370:Skint5 UTSW 4 113614110 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6646:Skint5 UTSW 4 113940777 missense possibly damaging 0.94
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense not run
R7142:Skint5 UTSW 4 113571594 missense not run
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- CATATGGACTGTGTAAACCTCTTAAAG -3'
(R):5'- TGCCTCTTGTCAGCCAGAAAAT -3'

Sequencing Primer
(F):5'- CCTCTTAAAGGGGCTATCCTAAG -3'
(R):5'- CTTGTCAGCCAGAAAATAATAAGCAG -3'
Posted On2015-04-02