Incidental Mutation 'R3816:Usp32'
ID274322
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Nameubiquitin specific peptidase 32
Synonyms6430526O11Rik, 2900074J03Rik
MMRRC Submission 040881-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R3816 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84984442-85140161 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 84994384 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
Predicted Effect probably benign
Transcript: ENSMUST00000000821
SMART Domains Protein: ENSMUSP00000000821
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
Pfam:UCH 32 260 4.1e-51 PFAM
Pfam:UCH_1 33 228 1.7e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108075
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Meta Mutation Damage Score 0.518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,830,494 I12N probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Abca2 A G 2: 25,446,071 Y2151C probably damaging Het
Adamts3 T A 5: 89,705,264 H509L probably damaging Het
Agfg2 T C 5: 137,653,774 D441G probably benign Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
As3mt A T 19: 46,707,777 D8V probably benign Het
Ass1 G T 2: 31,510,105 probably benign Het
Cdc42bpa A G 1: 180,144,886 I634V possibly damaging Het
Cflar T C 1: 58,752,423 V298A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dlec1 C T 9: 119,124,843 A610V probably damaging Het
Dock1 C T 7: 134,744,286 R186* probably null Het
E130018O15Rik T C 5: 35,382,766 noncoding transcript Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gipc2 T C 3: 152,165,844 K15R probably benign Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Glipr2 G T 4: 43,977,522 A51S possibly damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
H2-M10.2 A T 17: 36,286,362 Y20* probably null Het
Hlcs A G 16: 94,133,088 V242A probably benign Het
Ifi44 T C 3: 151,749,257 I110M possibly damaging Het
Il18r1 T C 1: 40,486,972 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Khk T C 5: 30,926,716 S80P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo1g A G 11: 6,510,926 V706A probably benign Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr700 A G 7: 106,805,820 I214T probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pdgfrb A G 18: 61,078,945 D844G probably damaging Het
Phf3 T C 1: 30,805,753 D1375G probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rac2 T C 15: 78,565,999 D47G possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall1 G T 8: 89,032,675 A267E probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpina3k A G 12: 104,340,962 E151G probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc51b A G 9: 65,414,018 probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Star G A 8: 25,809,877 M82I probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vwa3a A G 7: 120,800,379 T1028A probably benign Het
Xrn2 G A 2: 147,028,200 G270R probably damaging Het
Zbbx G T 3: 75,085,495 Q231K probably benign Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5381:Usp32 UTSW 11 85059127 critical splice donor site probably benign
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCAGCCTCTCACATTCTGGG -3'
(R):5'- GGCTAGGTGTTCATTTTAAATGCC -3'

Sequencing Primer
(F):5'- GCCTCTCACATTCTGGGATTAAAGG -3'
(R):5'- CCCCCTCTAATAGGTTGTAGAGGAG -3'
Posted On2015-04-02