Incidental Mutation 'R3816:Serpina3k'
ID274325
Institutional Source Beutler Lab
Gene Symbol Serpina3k
Ensembl Gene ENSMUSG00000058207
Gene Nameserine (or cysteine) peptidase inhibitor, clade A, member 3K
SynonymsRP54, MMSpi2, MMCM2, alpha-1 antiproteinase, D12Rp54, contrapsin, 1300001I07Rik, Spi-2, Spi2
MMRRC Submission 040881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R3816 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location104338486-104346144 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104340962 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 151 (E151G)
Ref Sequence ENSEMBL: ENSMUSP00000042095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043058] [ENSMUST00000101078]
Predicted Effect probably benign
Transcript: ENSMUST00000043058
AA Change: E151G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000042095
Gene: ENSMUSG00000058207
AA Change: E151G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 57 417 4.77e-195 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101078
SMART Domains Protein: ENSMUSP00000098639
Gene: ENSMUSG00000079012

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 56 417 3.12e-199 SMART
Meta Mutation Damage Score 0.1156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,830,494 I12N probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Abca2 A G 2: 25,446,071 Y2151C probably damaging Het
Adamts3 T A 5: 89,705,264 H509L probably damaging Het
Agfg2 T C 5: 137,653,774 D441G probably benign Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
As3mt A T 19: 46,707,777 D8V probably benign Het
Ass1 G T 2: 31,510,105 probably benign Het
Cdc42bpa A G 1: 180,144,886 I634V possibly damaging Het
Cflar T C 1: 58,752,423 V298A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dlec1 C T 9: 119,124,843 A610V probably damaging Het
Dock1 C T 7: 134,744,286 R186* probably null Het
E130018O15Rik T C 5: 35,382,766 noncoding transcript Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gipc2 T C 3: 152,165,844 K15R probably benign Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Glipr2 G T 4: 43,977,522 A51S possibly damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
H2-M10.2 A T 17: 36,286,362 Y20* probably null Het
Hlcs A G 16: 94,133,088 V242A probably benign Het
Ifi44 T C 3: 151,749,257 I110M possibly damaging Het
Il18r1 T C 1: 40,486,972 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Khk T C 5: 30,926,716 S80P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo1g A G 11: 6,510,926 V706A probably benign Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr700 A G 7: 106,805,820 I214T probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pdgfrb A G 18: 61,078,945 D844G probably damaging Het
Phf3 T C 1: 30,805,753 D1375G probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rac2 T C 15: 78,565,999 D47G possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall1 G T 8: 89,032,675 A267E probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc51b A G 9: 65,414,018 probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Star G A 8: 25,809,877 M82I probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Usp32 A G 11: 84,994,384 probably null Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vwa3a A G 7: 120,800,379 T1028A probably benign Het
Xrn2 G A 2: 147,028,200 G270R probably damaging Het
Zbbx G T 3: 75,085,495 Q231K probably benign Het
Other mutations in Serpina3k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Serpina3k APN 12 104343110 missense probably benign 0.36
IGL01402:Serpina3k APN 12 104340623 missense probably benign 0.00
IGL01404:Serpina3k APN 12 104340623 missense probably benign 0.00
IGL01958:Serpina3k APN 12 104341057 missense probably damaging 1.00
IGL02031:Serpina3k APN 12 104345266 missense probably benign 0.08
IGL02055:Serpina3k APN 12 104341036 nonsense probably null
IGL02981:Serpina3k APN 12 104340991 missense probably benign 0.02
IGL03269:Serpina3k APN 12 104340521 missense possibly damaging 0.83
R1076:Serpina3k UTSW 12 104340994 missense probably benign 0.00
R2360:Serpina3k UTSW 12 104340907 nonsense probably null
R4577:Serpina3k UTSW 12 104344192 missense possibly damaging 0.94
R4656:Serpina3k UTSW 12 104345273 missense probably damaging 1.00
R4732:Serpina3k UTSW 12 104340860 missense probably damaging 1.00
R4733:Serpina3k UTSW 12 104340860 missense probably damaging 1.00
R4916:Serpina3k UTSW 12 104343010 missense probably damaging 1.00
R4999:Serpina3k UTSW 12 104341046 missense probably damaging 1.00
R5053:Serpina3k UTSW 12 104343214 critical splice donor site probably null
R6300:Serpina3k UTSW 12 104340722 missense probably damaging 1.00
R6343:Serpina3k UTSW 12 104345303 missense probably benign
R6851:Serpina3k UTSW 12 104345366 missense probably benign 0.00
R6858:Serpina3k UTSW 12 104345245 missense possibly damaging 0.85
R6872:Serpina3k UTSW 12 104344260 missense probably benign 0.25
R6992:Serpina3k UTSW 12 104341107 missense probably benign 0.00
R7025:Serpina3k UTSW 12 104341142 missense probably benign 0.01
R7050:Serpina3k UTSW 12 104341144 missense possibly damaging 0.96
X0019:Serpina3k UTSW 12 104340575 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTAGCATCTCAGCTGCCTTGG -3'
(R):5'- TAGATGTAATTCACCAGCACCATC -3'

Sequencing Primer
(F):5'- TCGTGTCCCTGGGAGCAAAG -3'
(R):5'- CAATGTCCCATCATCCAGTTCTGAG -3'
Posted On2015-04-02