Incidental Mutation 'R3816:Hlcs'
ID274330
Institutional Source Beutler Lab
Gene Symbol Hlcs
Ensembl Gene ENSMUSG00000040820
Gene Nameholocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP-hydrolysing)] ligase)
SynonymsD16Jhu34, 410I21.SP6
MMRRC Submission 040881-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R3816 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94128882-94313571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94133088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 242 (V242A)
Ref Sequence ENSEMBL: ENSMUSP00000154157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099512] [ENSMUST00000163193] [ENSMUST00000227141] [ENSMUST00000227698] [ENSMUST00000228910]
Predicted Effect probably benign
Transcript: ENSMUST00000099512
AA Change: V637A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097112
Gene: ENSMUSG00000040820
AA Change: V637A

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 1.9e-21 PFAM
Pfam:BPL_C 665 714 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163193
AA Change: V637A

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130981
Gene: ENSMUSG00000040820
AA Change: V637A

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
Pfam:BPL_LplA_LipB 467 599 3.6e-30 PFAM
Pfam:BPL_C 665 714 4.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227141
AA Change: V784A

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227618
Predicted Effect probably benign
Transcript: ENSMUST00000227698
Predicted Effect probably benign
Transcript: ENSMUST00000228910
AA Change: V242A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.2%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the binding of biotin to carboxylases and histones. The protein plays an important role in gluconeogenesis, fatty acid synthesis and branched chain amino acid catabolism. Defects in this gene are the cause of holocarboxylase synthetase deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,830,494 I12N probably damaging Het
Aak1 T C 6: 86,959,042 probably benign Het
Abca2 A G 2: 25,446,071 Y2151C probably damaging Het
Adamts3 T A 5: 89,705,264 H509L probably damaging Het
Agfg2 T C 5: 137,653,774 D441G probably benign Het
Arl8b T A 6: 108,813,697 V65D probably damaging Het
As3mt A T 19: 46,707,777 D8V probably benign Het
Ass1 G T 2: 31,510,105 probably benign Het
Cdc42bpa A G 1: 180,144,886 I634V possibly damaging Het
Cflar T C 1: 58,752,423 V298A probably benign Het
Csmd1 C T 8: 16,002,522 A2201T probably damaging Het
Cyp4a12b A T 4: 115,432,470 D178V probably damaging Het
Dlec1 C T 9: 119,124,843 A610V probably damaging Het
Dock1 C T 7: 134,744,286 R186* probably null Het
E130018O15Rik T C 5: 35,382,766 noncoding transcript Het
Gabrg3 G A 7: 57,381,664 Q43* probably null Het
Gipc2 T C 3: 152,165,844 K15R probably benign Het
Gjb2 A G 14: 57,100,073 V226A probably benign Het
Glipr2 G T 4: 43,977,522 A51S possibly damaging Het
Gsdme A C 6: 50,219,411 S340A probably benign Het
H2-M10.2 A T 17: 36,286,362 Y20* probably null Het
Ifi44 T C 3: 151,749,257 I110M possibly damaging Het
Il18r1 T C 1: 40,486,972 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Khk T C 5: 30,926,716 S80P probably damaging Het
Ly9 G T 1: 171,589,085 T537N possibly damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo1g A G 11: 6,510,926 V706A probably benign Het
Npat T C 9: 53,569,916 S1008P probably damaging Het
Olfr483 A G 7: 108,103,498 Y63C possibly damaging Het
Olfr700 A G 7: 106,805,820 I214T probably damaging Het
Olfr876 C T 9: 37,804,169 S86L probably benign Het
Olfr889 A T 9: 38,116,626 T277S possibly damaging Het
Olfr922 A G 9: 38,816,426 K308E possibly damaging Het
Pcdha2 A G 18: 36,941,695 Y793C probably benign Het
Pcdhb4 A T 18: 37,308,012 D125V probably damaging Het
Pdgfrb A G 18: 61,078,945 D844G probably damaging Het
Phf3 T C 1: 30,805,753 D1375G probably damaging Het
Pigu A T 2: 155,299,143 F276I probably damaging Het
Pomgnt1 T A 4: 116,153,942 probably null Het
Psmd9 C T 5: 123,234,590 probably benign Het
Rac2 T C 15: 78,565,999 D47G possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sall1 G T 8: 89,032,675 A267E probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpina3k A G 12: 104,340,962 E151G probably benign Het
Skint5 A G 4: 113,629,122 probably benign Het
Slc51b A G 9: 65,414,018 probably benign Het
Sorl1 A G 9: 42,064,049 L487P possibly damaging Het
Sspo A T 6: 48,481,103 E3269V possibly damaging Het
Star G A 8: 25,809,877 M82I probably benign Het
Tnfrsf11a C T 1: 105,809,360 T64I probably damaging Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Usp32 A G 11: 84,994,384 probably null Het
Vmn2r18 T C 5: 151,561,683 N782S probably benign Het
Vwa3a A G 7: 120,800,379 T1028A probably benign Het
Xrn2 G A 2: 147,028,200 G270R probably damaging Het
Zbbx G T 3: 75,085,495 Q231K probably benign Het
Other mutations in Hlcs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01078:Hlcs APN 16 94133160 missense probably damaging 0.99
IGL02026:Hlcs APN 16 94134705 missense probably damaging 0.99
IGL02341:Hlcs APN 16 94231110 missense probably damaging 0.99
IGL03075:Hlcs APN 16 94138847 missense probably damaging 1.00
PIT4515001:Hlcs UTSW 16 94267416 missense probably benign 0.45
R0372:Hlcs UTSW 16 94138907 missense possibly damaging 0.69
R0664:Hlcs UTSW 16 94231311 missense probably damaging 1.00
R0731:Hlcs UTSW 16 94131852 missense probably damaging 1.00
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1465:Hlcs UTSW 16 94268292 missense probably damaging 0.99
R1761:Hlcs UTSW 16 94268007 missense probably benign 0.05
R2013:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2014:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2015:Hlcs UTSW 16 94262740 missense probably benign 0.17
R2204:Hlcs UTSW 16 94231152 missense probably benign 0.30
R2371:Hlcs UTSW 16 94268067 missense probably damaging 0.98
R3822:Hlcs UTSW 16 94267981 missense probably benign 0.04
R4422:Hlcs UTSW 16 94138960 missense possibly damaging 0.56
R4657:Hlcs UTSW 16 94262698 missense probably benign 0.00
R4783:Hlcs UTSW 16 94268539 missense possibly damaging 0.82
R5347:Hlcs UTSW 16 94267524 missense possibly damaging 0.93
R5808:Hlcs UTSW 16 94262632 missense probably benign 0.00
R5940:Hlcs UTSW 16 94134712 missense probably damaging 0.99
R6341:Hlcs UTSW 16 94231163 missense probably damaging 1.00
R6943:Hlcs UTSW 16 94141402 missense possibly damaging 0.75
R7053:Hlcs UTSW 16 94268015 missense possibly damaging 0.91
X0065:Hlcs UTSW 16 94133173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGCTTTTCCATCAGAGTTAAG -3'
(R):5'- GCTGGGAGAATCTGTACCTTTC -3'

Sequencing Primer
(F):5'- AGTTAAGAAATAAACTATCAGACCGG -3'
(R):5'- CTCTATGGTTGGAAGTCACCACAG -3'
Posted On2015-04-02