Incidental Mutation 'R3802:Prpf4b'
ID274371
Institutional Source Beutler Lab
Gene Symbol Prpf4b
Ensembl Gene ENSMUSG00000021413
Gene Namepre-mRNA processing factor 4B
SynonymsPrp4, Prp4k, Prpk
MMRRC Submission 040761-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3802 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location34875302-34906064 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 34883682 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000077853] [ENSMUST00000222509]
Predicted Effect unknown
Transcript: ENSMUST00000077853
AA Change: S165P
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413
AA Change: S165P

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221639
Predicted Effect unknown
Transcript: ENSMUST00000222509
AA Change: S165P
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik G T 14: 8,510,931 D494E probably benign Het
9230104L09Rik T C 2: 148,850,696 H62R probably benign Het
Abcc2 C A 19: 43,821,626 N874K probably benign Het
Axl A T 7: 25,788,477 M1K probably null Het
Btaf1 A T 19: 36,986,548 T840S probably benign Het
Btaf1 A T 19: 36,988,973 H1047L probably benign Het
Capn13 G A 17: 73,339,401 P339L probably benign Het
Ccdc105 A C 10: 78,748,480 F367C probably damaging Het
Ccdc39 A T 3: 33,819,895 M596K probably damaging Het
Cfap58 G T 19: 47,953,059 D289Y possibly damaging Het
Cnn2 A G 10: 79,993,495 D153G probably benign Het
Cubn T C 2: 13,360,353 I1625V probably benign Het
Gm13178 A T 4: 144,703,504 L305Q possibly damaging Het
Gprc5b C T 7: 118,983,720 D309N possibly damaging Het
Grm8 T G 6: 28,125,636 N164H possibly damaging Het
Gstm3 G A 3: 107,964,235 T210I probably benign Het
H2-Ke6 A T 17: 34,026,467 V231E probably damaging Het
Hhipl1 A G 12: 108,312,307 E298G probably benign Het
Hivep2 A G 10: 14,148,961 D2173G possibly damaging Het
Jarid2 T A 13: 44,902,831 N365K probably benign Het
Kank4 A G 4: 98,780,133 S26P probably damaging Het
Kpnb1 A T 11: 97,166,129 V638E possibly damaging Het
Lipo1 C T 19: 33,784,857 C80Y probably damaging Het
Mga T A 2: 119,947,339 N1788K probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr10 A G 7: 64,320,628 Y373C probably benign Het
Ncoa6 C T 2: 155,405,564 G1940D probably benign Het
Nelfe T A 17: 34,853,901 F166L possibly damaging Het
Nfatc3 A G 8: 106,079,645 Y374C probably damaging Het
Nhlrc3 A G 3: 53,458,631 V147A possibly damaging Het
Olfr583 A G 7: 103,052,165 Y289C probably benign Het
Olfr952 G A 9: 39,426,286 P262S probably damaging Het
Pak3 G A X: 143,709,731 V87I probably damaging Het
Papolg A T 11: 23,876,449 I235N probably damaging Het
Pdgfrl T C 8: 40,985,557 S177P probably damaging Het
Phf8 T C X: 151,572,576 S512P possibly damaging Het
Plaa T C 4: 94,569,888 D615G probably damaging Het
Sgk1 T C 10: 21,997,412 V259A probably damaging Het
Skint4 G T 4: 112,118,181 V113L probably damaging Het
Smco1 A G 16: 32,273,898 Y129C probably benign Het
Tas2r106 C A 6: 131,678,366 S174I probably benign Het
Tsn A T 1: 118,305,296 F93I probably damaging Het
Vav2 T C 2: 27,267,223 probably benign Het
Vmn2r63 A T 7: 42,903,405 M809K probably damaging Het
Zfp260 G A 7: 30,105,079 E135K probably benign Het
Zfp808 T A 13: 62,172,083 H375Q probably damaging Het
Zkscan2 A T 7: 123,495,142 probably benign Het
Other mutations in Prpf4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Prpf4b APN 13 34883907 missense probably benign 0.23
IGL00639:Prpf4b APN 13 34899173 missense possibly damaging 0.70
IGL00901:Prpf4b APN 13 34894482 missense probably damaging 1.00
IGL01301:Prpf4b APN 13 34884291 missense probably benign 0.23
IGL02027:Prpf4b APN 13 34889571 missense probably benign 0.35
IGL02111:Prpf4b APN 13 34883961 missense probably benign 0.23
IGL02256:Prpf4b APN 13 34899878 missense probably damaging 0.98
IGL02590:Prpf4b APN 13 34888146 unclassified probably benign
IGL03389:Prpf4b APN 13 34900456 splice site probably benign
IGL03411:Prpf4b APN 13 34895359 missense probably damaging 1.00
ANU18:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4260001:Prpf4b UTSW 13 34884291 missense probably benign 0.23
PIT4696001:Prpf4b UTSW 13 34899842 missense probably benign 0.01
R0114:Prpf4b UTSW 13 34890488 splice site probably benign
R0157:Prpf4b UTSW 13 34884031 unclassified probably benign
R1551:Prpf4b UTSW 13 34894443 missense possibly damaging 0.91
R1587:Prpf4b UTSW 13 34892150 missense probably benign 0.09
R2105:Prpf4b UTSW 13 34884231 unclassified probably benign
R2152:Prpf4b UTSW 13 34900419 missense probably benign 0.04
R2432:Prpf4b UTSW 13 34883341 unclassified probably benign
R3803:Prpf4b UTSW 13 34883682 unclassified probably benign
R3804:Prpf4b UTSW 13 34883682 unclassified probably benign
R3982:Prpf4b UTSW 13 34884213 unclassified probably benign
R4603:Prpf4b UTSW 13 34888164 unclassified probably benign
R4633:Prpf4b UTSW 13 34900442 missense probably damaging 1.00
R4649:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4651:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R4653:Prpf4b UTSW 13 34899971 missense probably benign 0.06
R5022:Prpf4b UTSW 13 34883599 unclassified probably benign
R5028:Prpf4b UTSW 13 34899975 missense probably damaging 1.00
R5232:Prpf4b UTSW 13 34883590 unclassified probably benign
R5313:Prpf4b UTSW 13 34894549 missense probably damaging 1.00
R5440:Prpf4b UTSW 13 34884093 unclassified probably benign
R5511:Prpf4b UTSW 13 34884054 unclassified probably benign
R5863:Prpf4b UTSW 13 34899128 missense possibly damaging 0.51
R5981:Prpf4b UTSW 13 34886710 missense probably benign 0.23
R6360:Prpf4b UTSW 13 34901433 missense probably damaging 0.99
R6398:Prpf4b UTSW 13 34900371 missense probably damaging 1.00
R6556:Prpf4b UTSW 13 34896032 missense probably damaging 0.98
R6880:Prpf4b UTSW 13 34894453 missense possibly damaging 0.69
R7133:Prpf4b UTSW 13 34901494 missense probably benign 0.02
R7148:Prpf4b UTSW 13 34894472 missense probably benign 0.04
R7208:Prpf4b UTSW 13 34884011 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCTTTGCTGGAAGACTTGG -3'
(R):5'- AGCTTGGTCTTGAGACTTGC -3'

Sequencing Primer
(F):5'- CTTTGCTGGAAGACTTGGAAAAGC -3'
(R):5'- GATGGGCTTTTGGATTTTCTCCTCTC -3'
Posted On2015-04-02